태초에 하나님이 천지를 창조하시니라 (창세기 1:1)

미디어위원회
2020-08-20

끝까지 버티는 다윈의 신화

: 흔적기관과 침팬지와 유사성이 98.8%라는 거짓 주장

(Darwin Myths Die Hard)

Jerry Bergman


      진화론의 신화는 부정된 후에도 오랫동안 지속된다. 어떤 경우에는 150년 이상!


   인간의 기원에 대한 다윈의 이야기를 뒷받침하는 진화론적 신화들은 위조로 판명된 이후에도 대중에게 무비판적으로 받아들여지는 경향이 있다. 다음은 몇 가지 예이다.


흔적기관

하나의 예는, 사람 눈에서 "깜박막(nictitating membrane, 순막)"으로 주장됐던 것이다. 이것은 먼 진화론적 조상으로부터 남겨진 흔적기관이라는 것이었다. 라틴어로 눈 깜박임(nictare)에서 유래한 깜박막은 시력을 유지하면서, 눈을 먼지로부터 보호하고, 수분을 공급하기 위해 눈을 가로질러 움직일 수 있는, 투명한 제3의 눈꺼풀이다. 다윈은 이 구조에 관해 설명하면서, 파충류가 우리의 조상이라는 증거로 사용하였다.

.2019년 발간된 제리 버그만의 책, ‘쓸모없는 기관 : 진화론의 한 중심적 주장의 흥망성쇠(Useless Organs : the Rise and Fall of a Central Claim of Evolution)’ 


그러나 1920년대에 주장됐던 사람 눈에서의 깜박막은 사실 깜박거리는 막도 아니고, 흔적기관도 아니었다. 그것은 반월주름(plica semilunaris, 반달모양의 주름)이었다. 그것은 매우 다른 목적을 갖고 있는 매우 다른 구조였다. 반월주름은 눈의 내안각에 있는 작은 결막 조직의 주름으로, 눈물의 배수를 유지하고, 안구의 회전을 더욱 원활하게 해준다.[1] 실제로 이 반월주름이 없다면, 결막은 안구에 직접 부착되어 움직임이 제한된다.[2] 이 잘못된 깜박막 개념은 1871년 찰스 다윈(Charles Darwin)이 아닌 다른 누군가에 의해 시작되었다. 하지만, 그것은 여전히 1세기 반이 지나서도 흔적기관의 주요한 예로써 계속 선전되고 있는 것이다![3] 권위 있는 브리태니커 백과사전(Encyclopedia Britannica)은 흔적기관 목록에서 4번째로 깜박막을 올려놓고 있다![4] 브리태니커 백과사전은 흔적기관을 “진화 역사의 잔존물”로 설명하고 있다.


1% 라는 신화

최근 비즈니스 인사이더(Business Insider) 지는 또 다른 다윈의 신화를 강조해서 말하고 있었다. “우리의 유전자(DNA)는 바로 옆 사람과 99.9%가 동일하다. 인간의 유전자는 놀랍게도 다른 생물의 유전자와도 많이 비슷하다.” 그 기사는 침팬지와 키스하고 있는 영장류 과학자 제인 구달(Jane Goodall)의 사진과 함께 소개되고 있었다. 애니메이션의 삽화와 강조된 굵은 글씨를 사용하여, 유사성 목록(list of similarities)을 만들어 다윈주의를 선전하고 있었다.

• 인간과 인간의 유전적 유사성은 99.9%이다.

• 인간과 침팬지의 유전적 유사성은 96%이다.

• 인간과 고양이의 유전적 유사성은 90%이다.

• 인간과 쥐의 유전적 유사성은 85%이다.

• 인간과 젖소의 유전적 유사성은 80%이다

• 인간과 초파리의 유전적 유사성은 61%이다.

• 인간과 닭의 유전적 유사성은 60%이다.

• 인간과 바나나의 유전적 유사성은 60%이다.[5]

이것은 인간과 진화론적으로 먼 친척들로부터 가까운 생물들을 배치하면서, 우리가 진화론적으로 진보하여 왔음을 홍보하려는 뻔뻔한 시도이다. 그들의 주장에 의하면, 인간과 닭의 유전적 거리가 인간과 바나나와의 거리와 같다고 결론내리고 있는데, 얼마나 터무니없는 것인가? 그러나 자세히 들여다보면, 이 기사의 문제점은 인간과 쥐 사이의 85% 유사성은, 단지 단백질을 인코딩하는 유전자(protein-encoding genes)만을 비교한 것이다. 단백질을 코딩하지 않는 유전자(non-protein coding genes)의 경우, 유사성은 단지 약 50%에 지나지 않는다. 실제로 인간과 침팬지를 비교하기 위해서는, 이런 부분이 강조되어야 한다. 일반 독자는 제목만 보고, 정작 그 안에 있는 중요한 사실을 놓치게 된다.

구글에서 검색해보면, 침팬지와 인간의 유전적 유사성은 95%, 심지어 99%라고 쓰고 있는 수천의 글들을 보게 된다. 그러한 주장은 책 제목으로도 발견되는데, ‘인간과 침팬지 : 인간과 침팬지의 유전자는 96% 유사하다’라는 책도 있다.[6] 이 책에서 “연구자들은 침팬지의 유전자 염기서열을 분석했으며, 사람과 침팬지는 96%가 유사하다는 것을 발견했다. 모두가 알아야 할 매우 흥미로운 정보이다”라고 말한다. 또 다른 제목의 책은 “99% 원숭이: 진화는 어떻게 발전하는가”이다.[7] 이 책은 제목에서부터 ‘인간은 원숭이와 99% 같다’라고 주장하고 있다. 이런 잘못된 주장을 일부 유신진화론자(theistic evolutionists)들은 받아들이고 있다. 예를 들어, 캐나다에서 가장 큰 기독교대학의 생물학 교수이며, BioLogos의 유신진화론자인 데니스 베니머(Dennis Venema)는 다음과 같이 썼다. “우리 전체의 유전체가 침팬지와 95% 혹은 98% 동일하다고 하는 것의 의미는 우리의 유전자 가운데 작은 DNA 블록들이 얼마나 소실되었는가에 달려있다.”[8]

마찬가지로, 단 1%의 차이라는 신화는 선도적 과학 잡지들에서 끊임없이 반복되고 있다. Smithsonian Magazine의 ‘현재 상태를 유지하는 현명한 소식’이라는 제목의 기사에서 "99% 침팬지라는 것은 무엇을 의미할까?"라고 묻고 있다. 그런 다음 그 기사는, 그것이 의미하는 바는, 즉 우리 인간은 99% 침팬지라는 것이다. 가장 권위 있는 과학저널에서도 이런 잘못된 거짓 신화는 구역질날 정도로 반복되고 있다. Scientific American의 기사는 “대부분의 연구에서 침팬지와 인간 사이에서 유전체가 비교됐을 때, 약 98.5%의 염기서열이 동일하다는 것이 밝혀졌다”고 말한다.[9] 또 다른 예로, Science 지는 “2005년 침팬지의 유전체가 분석된 이후로, 인간과 침팬지의 유전자는 약 99%를 공유하고 있고, 침팬지는 우리의 가장 가까운 친척이다”라고 말하고 있었다.[10] 마지막 예로, Nature 지의 한 보고는 “우리 DNA의 거의 98% 이상이 가장 가까운 살아있는 친척인 침팬지와 같다”고 쓰고 있었다.[11]


1%라는 주장이 산산조각 남

그러나 이러한 주장은 최근의 연구에 의해 산산조각이 났다. 미국을 대표하는 과학 잡지인 Science 지의 한 기사는 “상대적 차이: 1%라는 신화”라는 제목의 글을 보고했다.[12] 이 기사는 올해 발표된 것이 아니다. 이 논문은 13년 전인 2007년에 게재됐던 것이다! 그러나 그 이후에도 그러한 신화는 책들과 기사들에서 반복되어왔던 것이다! 저자는 1% 라는 주장이 처음부터 문제가 있었다고 설명하고 있었다 :

2005년에 침팬지 시퀀싱 및 분석 컨소시엄(Chimpanzee Sequencing and Analysis Consortium)의 연구자들은 우리와 가장 가까운 친척인 침팬지의 유전체를 연구하여, 가장 극적인 증거들을 발표했다. 컨소시엄 연구자들은 인간과 침팬지 각각에서 24억 개의 염기서열을 분석했으며, 이들이 1.23 %의 차이를 나타낸다고 보고했다. 그러나 침팬지 컨소시엄이 지적한 바와 같이, 이 수치는 유전체에 삽입되거나 삭제된 유전자(DNA) 전체가 아니라, 단지 염기가 치환(base substitutions)된 것만을 반영한 것이었다.[13]   

더 심도 깊은 연구는 훨씬 큰 차이가 있음을 밝혀냈다. "한(Hahn) 및 동료들은 2006년 12월 PLoS ONE 지에 발표된 논문에서, 인간과 침팬지 유전자 복사본의 수(gene copy numbers)는 무려 6.4%의 많은 차이가 났다"고 밝혔다.[14] 그리고 그들은 시스템 생물학(systems biology)을 이용하여, 인간과 침팬지 뇌의 유전적 차이를 정량화하고 분석했다. UCLA 생물 통계학자 스티브 호르벳(Steve Horvath)과 게쉬윈드(Geschwind)는 절제된 뇌의 특정 영역에서 4,000여개의 유전자들이 동시에 켜지거나, "동시 발현된" 유전자를 비교했다. 이러한 데이터를 바탕으로, 각 종(種)에 대한 유전자 네트워크를 구축했다. 그들은 “네트워크에서 한 유전자의 위치는 커다란 의미를(유사성 비율은 매우 제한적임을) 갖는다”라는 결론을 내렸다. 다른 유전자와 가장 빈번하게 공동 발현되는 유전자들은 가장 기능적으로 관련 있는 것으로 밝혀졌다.[15] 그리고 2006년 기사에서 “각 생물 종의 각각의 군집 네트워크 지도(map)에 대한 비교는 특정 연결이 인간에게는 있지만, 침팬지에는 존재하지 않음을 분명히 보여주었다. 예를 들어, 피질(cortex)에서 이런 연결의 17.4%는 인간에게만 고유한 것이다.”[16]

지금은 2020년이다. 그래서 인각과 침팬지의 유사성 문제는 확실히 해결되었다. 그렇다면 정확히 몇 %가 다르다고 말할 수 있을까? 이에 대해서는 2007년 기사를 인용하는 것이 좋을 것이다 :

연구자들이 밝혀낸 모든 것을 결합하여, 인간과 침팬지의 차이를 정확하게 몇 %라고 말할 수 있을까? 침팬지 컨소시엄의 한 연구자인 독일 라이프치히의 막스플랑크 진화인류학 연구소(Max Planck Institute of Evolutionary Anthropology)의 유전학자 스반테 파보(Svante Päabo)는 “나는 숫자를 계산할 방법이 없다고 생각한다. 결국, 우리가 차이점을 보는 방법은 정치적, 사회적, 문화적 문제이다.”

이것은 이 이슈에 대해 잘 설명하고 있으며, 13년 전에 대중에게 들려졌어야 했다. “결국 우리가 차이점을 보는 방법은 정치적, 사회적, 문화적 문제이다”라는 스반테 파보(Svante Päabo)의 말은 정확한 것이다. 1%의 차이라는 주장은 과학이 아니라, 정치적 목적을 위한 과학의 심각한 왜곡이다. 그 기사는 “오늘날 두 종은 유전적으로 99% 동일하다는 것으로 받아들여지고 있다.” 그리고 “1%의 차이는 자명한 이치라는 주장은 철회되어야 한다”고 덧붙였다. 지난 13년 동안 진화론자들은 이런 현명한 사람들의 충고를 무시했다.


최신 연구

더 자세한 최근 연구에 따르면, 최상의 유전자 비교 추정치는 99%, 95%, 또는 90%가 아니라, 약 84%의 유사성에 불과하다는 것이다. 16%의 차이는 약 5천만 개의 염기쌍이 다르다는 것을 나타낸다.[17] 23개의 인간 염색체의 길이는 약 1.8m로, 적절한 길이로 나누어 시퀀싱을 하고, 조립하여 분석한다. 초기 DNA 시퀀싱 작업에서, 과학자들은 매우 짧은 DNA 분절(segments)에 대해서만 염기서열을 분석할 수 있었다.

따라서 연구자들은 혈액 글로빈(globin) 단백질과 같은, 동물들 사이에서 매우 유사할 것으로 생각되는 DNA 분절에 초점을 맞추었다. 그러나 이 유전자들에서도 문제가 있었다. 침팬지 유전체(genome)은 인간 유전체보다 훨씬 길다 : 인간 유전체에는 3,096,649,726개의 염기쌍이 있고, 침팬지 유전체에는 3,309,577,922개의 염기쌍이 있다. 즉 6.4%의 개수 차이가 난다.[18] 더군다나, 인간은 46개의 염색체를 갖고 있고, 침팬지는 48개의 염색체를 갖고 있다. 따라서 아래와 같이(첫 번째 줄과 두 번째 줄 사이에) 거의 일치하지 않는 두 염기서열의 유전자를 비교하는 것은 어렵다 : 

ATTTGGGGTCCTTTTCCCGTAGTAACCTTCCCAAATGTTTGGCATCGTACGCTG

AAGGGTTGGGGAATATAGGGCGCGCGTATAGCGCGTGTGTTCTCTCGTACTAA

진화론자들은 이러한 거대한 차이가 나는 부분을 무시하고, 유사성에 초점을 맞추는 경향이 있다. 또한 비코딩 영역(non-coding regions)은 중요한 조절 기능을 갖고 있는 것으로 확인되고 있다. 이것이 확인되기 전까지 '정크(쓰레기) DNA(junk DNA)'라고 불렸었다.

여기 또 다른 오류가 있다. 인간에는 존재하지만, 침팬지에는 존재하지 않는 DNA 염기서열은 의미 있는 비교를 할 수 없게 만든다. 따라서 비교는 주로 헤모글로빈과 같은, 혈액 세포 단백질의 암호가 들어있는 유전자 영역을 비교하는 것이었다. 헤모글로빈이 기능하기 위해서는, 단백질이 매우 특정한 모양이어야 하기 때문에, 그들은 매우 유사한 유전자를 가질 것으로 예상될 수 있다. 결과적으로, 동일한 기능적 유사성을 필요로 하는 종들 사이에는 상당한 유사성이 존재할 수 있다. 그러나 중요하지 않다고 생각하는, 비코딩 영역은 훨씬 많은 차이를 보여주고 있음에도, 코딩 영역만으로 유사성을 주장한다면, 전체 유전체의 유사성은 상당히 왜곡되는 것이다.

그리고 일부 연구자들의 연구는 일종의 사기(fraud)인 것이다. 침팬지 염기서열을 분석한 한 실험실은, 진화론적 가정에 기초하여, 침팬지에는 없는(존재하지 않는) 염기서열이 있는 유전자의 경우, 그 간격을 메우기 위해서 침팬지 유전체에 인간 DNA 염기서열을 삽입했음을 인정하고 있었다. 따라서 논문으로 보고된 침팬지 유전체의 염기서열 분석은 부분적으로 인간 유전체를 기반으로 한 것이므로, 결과적으로 실제보다 훨씬 더 인간에 가까운 것으로 보여지는 것이다!

또 다른 주의해야할 사항은 단백질 암호를 갖고 있는 코딩 유전자는 선택적 접합(alternative splicing, 선택적 스플라이싱, 잘라붙임)을 통해, 많은 다른 개별 m-RNA 변이체들을 생산해낼 수 있다. 예를 들어, 단지 30,000개 이하의 유전자로 백만 가지 이상의 단백질들을 만들어낼 수 있으며, 이는 인간에 존재하는 것으로 추정되는 유전자의 수에 가깝다. 이러한 변이체들 중 다수는 후성유전학적(epigenetic) 메커니즘을 통해 생산된다.

따라서 인간 유전자와 침팬지 유전자는 유사성이 있다 하더라도, 발현되는 단백질들에서 큰 차이를 만들어낼 수 있다. 인간과 침팬지의 후생유전학적 차이는 유전자 자체의 차이보다 훨씬 클 가능성이 높다. 이 몇 가지 요점들은 인간과 침팬지 유전자형 사이에 커다란 간격이 존재하며, 이는 인간과 침팬지 표현형 사이에 존재하는 간격을 설명하는데 도움이 된다.


요약

다윈의 신화에 대한 이 두 가지 사례(눈의 흔적기관과 인간과 침팬지의 1% 차이)는 필자의 책에서 보고했던 많은 진화론의 오류, 사기, 위조들 중 하나이다. 그들은 모두 하나의 공통점을 갖고 있다. 즉, 진화론자들은 강한 동기를 갖고 진화론을 과학적으로 그럴듯하게 보이기 위해 애쓰고 있다는 것이다. 우리가 보았듯이 사실은 그렇지 않다. 그럼에도 불구하고, 많은 진화론의 신화들은 과학자들과 언론 기자들에 의해서 대중에게 계속 호도(糊塗)되고 있는 것이다.

.2017년 제리 버그만의 책, '진화론의 사기, 실수 및 위조(Evolution's Blunders, Frauds and Forgeries)'.



References

[1] Bergman, Jerry. 2019. Useless Organs: The Rise and Fall of the Once Major Argument for Evolution. Tulsa, OK: Bartlett Publishing.

[2] Dartt, Darlene A. 2006. “The Conjunctiva—Structure and Function.” Chapter 2 in Duane’s Foundations of Clinical Ophthalmology.  Philadelphia, PA: Lippincott Williams & Wilkins.

[3]  Darwin, Charles. 1871. The Descent of Man, and Selection in Relation to Sex. London, England, UK: John Murray, pp. 23, 207 in Volume 1.

[4] Rogers, Kara. “7 Vestigial Features of the Human Body.” Encyclopaedia Brittanica. https://www.britannica.com/list/7-vestigial-features-of-the-human-body

[5] Lydia Ramsey and Samantha Lee, “Our DNA is 99.9% the same as the person next to us — and we’re surprisingly similar to a lot of other living things.” Business Insider, April 3, 2018.

[6]  [Could not locate cited source. An alternate suggested reference: https://www.genome.gov/15515096/2005-release-new-genome-comparison-finds-chimps-humans-very-similar-at-dna-level.]

[7] Silvertown, Jonathan (ed.). 2009. 99% Ape: How Evolution Adds Up. Chicago, IL: The University of Chicago Press.

[8] The BioLogos Forum. https://discourse.biologos.org/t/human-chimp-genome-similarity/38409.

[9] Deininger, Prescott. 2004. What does the fact that we share 95 percent of our genes with the chimpanzee mean? And how was this numbered derived?  Scientific American. March 1. https://www.scientificamerican.com/article/what-does-the-fact-that-w/

[10] Gibbins, Ann. 2012. Bonobos Join Chimps as Closest Human Relatives. Science. June 13.  https://www.sciencemag.org/news/2012/06/bonobos-join-chimps-closest-human-relatives

[11] Gunter, Chris, and Ritu Dhand. 2005. The chimpanzee genome. Nature 437: 47, September 1. https://www.nature.com/collections/srwbvyfghj.

[12] Cohen, Jon. 2007. “Relative Differences: The Myth of 1%.” Science 316:1836, June 29.

[13] Cohen, 2007, p. 1836.

[14] Cohen, 2007, p. 1836.

[15] Cohen,  2007, p. 1836. Emphasis added.

[16] Cohen,  2007, p. 1836.

[17] Bergman, Jerry. 2020. Apes as Ancestors: Examining the Claims About Human Evolution. Tulsa, OK: Bartlett Publishing. Co-Authored with Peter Line, Ph.D., and Jeffrey Tomkins, Ph.D. Chapter 5: “Are Humans and Chimps 98% Similar?” Jeffrey Tomkins, Ph.D. & Jerry Bergman, Ph.D.

[18] http://useast.ensembl.org/Homo_sapiens/Info/Annotation.


*Dr. Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology for over 40 years at several colleges and universities including Bowling Green State University, Medical College of Ohio where he was a research associate in experimental pathology, and The University of Toledo. He is a graduate of the Medical College of Ohio, Wayne State University in Detroit, the University of Toledo, and Bowling Green State University. He has over 1,300 publications in 12 languages and 40 books and monographs. His books and textbooks that include chapters that he authored are in over 1,500 college libraries in 27 countries. So far over 80,000 copies of the 40 books and monographs that he has authored or co-authored are in print. For more articles by Dr Bergman, see his Author Profile.


*관련기사 : 인간과 DNA 98.8% 일치하는 침팬지 (중앙일보. 2020. 1. 4)

https://news.joins.com/article/22257317


*참조 : 사람과 침팬지의 DNA 유사성이 98% 이상인가? 그렇지 않다.

http://creation.kr/Variation/?idx=1290341&bmode=view

인간의 2번 염색체에서 융합은 결코 일어나지 않았다 : 사람과 원숭이류의 염색체 수 차이에 대한 진화론적 설명의 실패

http://creation.kr/Apes/?idx=3876591&bmode=view

보노보 유전체 해독에서 반-진화론적 비밀 : 유사한 영역만 비교하여 98.7%가 유사하다?

http://creation.kr/Apes/?idx=1852163&bmode=view

사람과 원숭이의 유전자 차이는 이전 보고의 4배

http://creation.kr/Mutation/?idx=1289754&bmode=view

사람과 침팬지 사이의 유전적 차이가 재계산되었다. 

http://creation.kr/Apes/?idx=1852205&bmode=view

1%의 신화 : 인간과 침팬지의 DNA는 매우 다르다.

http://creation.kr/Apes/?idx=1852185&bmode=view

사람과 침팬지의 Y 염색체 차이는 30% 이상이었다. 

http://creation.kr/Apes/?idx=1852097&bmode=view

진화론자들의 Y 염색체 충격 : 침팬지와 사람의 Y 염색체는 ‘끔찍하게’ 달랐다.

http://creation.kr/IntelligentDesign/?idx=1291705&bmode=view

사람과 침팬지의 DNA가 유사하다면, 왜 그렇게 많은 육체적 정신적 차이가 있는가?

http://creation.kr/Variation/?idx=1290374&bmode=view

사람과 침팬지의 DNA는 완전히 달랐다.

http://creation.kr/IntelligentDesign/?idx=1291692&bmode=view

사람 lincRNA 유전자는 진화론을 부정한다. : 침팬지의 lincRNA와 차이는 20% 이상이었다.

http://creation.kr/IntelligentDesign/?idx=1291733&bmode=view

또 하나의 진화론적 상징물이 무너졌다 : 진화론자들도 인간과 침팬지 DNA의 99%가 유사하다는 생각을 단념하다

http://creation.kr/Apes/?idx=1852048&bmode=view


출처 : CEH, 2020. 5. 27.

주소 : https://crev.info/2020/05/darwin-myths-die-hard/

번역 : 미디어위원회



















미디어위원회
2020-06-30

북극곰과 갈색곰보다 사람과 네안데르탈인이 더 유사하다.

(Humans and Neanderthals More Similar Than Polar and Brown Bears)

by Jeffrey P. Tomkins, PH.D.  


      옥스퍼드대학 연구자들의 연구는 최근 네안데르탈인(Neanderthals)과 사람(humans)은 서로 유전적으로 매우 유사했으며, 상호교배가 가능하다는 것을 확인했다. 그들은 북극곰과 갈색곰 사이 보다 훨씬 더 가까웠으며, 그들은 꽤 쉽게 생존 가능한 후손을 낳을 수 있었다는 것이다.[1] 이전의 수많은 DNA 연구와 함께, 이 연구는 네안데르탈인이 전 지구적 홍수 이후, 노아의 세 아들과 며느리들의 후손인 인류 가계의 고대 그룹임을 확인해주고 있었다.[2~4]

해부학적으로 현대인과 가까운 네안데르탈인, 데니소바인(Denisovans), 고대인들의 교배에 대한 분석은 지난 10년간 화석 뼈와 치아에서 추출한 고대 DNA의 분석을 통해 점점 더 입증되어왔다. 그러나 많은 진화론자들은 여전히 현생인류와 그들의 고대 사촌들은 근본적으로 다르다고 주장하며, 생존 가능한 후손을 낳을 수 있을 가능성은 극히 낮을 것이라고 주장한다.

이 새로운 연구에서, 연구자들은 두 포유류 종의 교배 사이에서 태어난 1세대 잡종 새끼의 번식력을 예측하기 위한 유전적 거리 측정법을 개발했다. 그들은 이미 잡종 새끼를 생산한 것으로 알려져 있는, 다른 포유류 종의 유전자 서열을 분석하여 이를 수행했다. 유전적 거리와 자손 번식력을 연관시킴으로써, 유전적 거리가 클수록 자손이 번식력을 가질 가능성이 줄어든다는 것을 보여주었다. 그런 다음 연구자들은 유전적 거리 값을 효과적으로 사용하여, 다양한 포유류의 번식력을 결정했다.

사람, 네안데르탈인, 데니소바인 사이의 유전적 거리가 계산되었을 때, 그 값은 야생에서 쉽게 잡종 번식을 하는 것으로 알려진 다양한 동물들 사이보다, 훨씬 더 가까웠다. 즉 짝짓기를 하는 갈색 곰과 북극곰 사이, 늑대와 코요테 사이보다 더 가까웠다는 것이다. 연구책임자인 옥스퍼드 대학의 그레거 라슨(Greger Larson) 교수는 “사람과 네안데르탈인과 데니소바인은 쉽게 번식력 있는 자손을 낳을 수 있었다”고 말했다.[5]

이러한 발견은 네안데르탈인은 완전한 사람이었다는 것을 다시 한 번 확인시켜준다. 창조론자들은 네안데르탈인은 노아 홍수 직후에 살았을 것이라고 믿고 있다. 왜냐하면 일반적으로 그들의 유골은 의식적으로 매장된 동굴 무덤에서, 그리고 신생대 암석층의 꼭대기에 있는 신제3기-제4기(Neogene-Quaternary, N-Q) 경계면에서 발견되기 때문이다.[6] 네안데르탈인의 DNA는 현대인과 동일할 뿐만 아니라, 소위 고대인의 특징이라는 발달된 눈썹 융기부와 경사진 이마는 오늘날 살아있는 현대인에서도 볼 수 있다.[7] 다시 한 번 과학적 사실은 인간 진화 이야기는 신화이며, 성경이 사실임을 확인시켜주고 있는 것이다.


References 

1. Allen, R. et al. 2020. A mitochondrial genetic divergence proxy predicts the reproductive compatibility of mammalian hybrids. Proceedings of the Royal Society. 287 (1928).
2. Tomkins, J. P. DNA Proof That Neandertals Are Just Humans. Creation Science Update. Posted on ICR.org February 21, 2014, accessed June 15, 2020.
3. Tomkins, J. P. Ancient Human DNA: Neandertals and Denisovans. Acts & Facts. 43 (3).
4. Tomkins, J. P. 2020. Neanderthal DNA Muddles Evolutionary Story. Creation Science Update. Posted on ICR.org April 7, 2020, accessed June 15, 2020.
5. Staff Writer. Humans and Neanderthals: less different than polar and brown bears. University of Oxford News and Events. Posted on ox.ac.uk June 3, 2020, accessed June 15, 2020.
6. Clarey, T. L. 2020. Compelling Evidence for an Upper Cenozoic Flood Boundary. Acts & Facts. 49 (5).
7. Tomkins, J. P. 2019. Recent Humans with Archaic Features Upend Evolution. Acts & Facts. 48 (4).

 *Dr. Tomkins is Life Sciences Director at the Institute for Creation Research and earned his doctorate in genetics from Clemson University. 


*참조 : 네안데르탈인은 결국 완전한 사람이었다 : 네안데르탈인의 폐활량은 현생인류보다 더 컸다.

http://creation.kr/Human/?idx=1757435&bmode=view

동굴 벽화를 그렸던 네안데르탈인은 완전한 현생인류였다!

http://creation.kr/Apes/?idx=1852253&bmode=view

네안데르탈인의 유전자 : 진화론자들은 그들이 너무도 틀렸음에 놀라고 있었다.

http://creation.kr/Apes/?idx=1852214&bmode=view

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://www.kacr.or.kr/library/print.asp?no=6876

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

벼랑 끝에 선 인류의 ‘아프리카 기원설’ : 선호되던 인간 진화 이야기는 이제 고군분투하고 있다.

http://creation.kr/Apes/?idx=3630150&bmode=view

그리스 트라칠로스에서 발견된 570만 년 전의 완전한 사람발자국으로 붕괴되고 있는 인류 진화론

http://creation.kr/Apes/?idx=1852249&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view

드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?idx=1852224&bmode=view

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view

원숭이도 무심코 돌 도구(석기)를 만들고 있었다 : 초기 인류가 만들었다는 타제석기는 의문스럽게 되었다.

http://creation.kr/Apes/?idx=1852220&bmode=view

인류의 농업은 진화론적 시간 틀로 너무 늦게 시작됐다. 인류는 13,000년 전에 이르러서야 농업을 시작했다?

http://creation.kr/Apes/?idx=1852177&bmode=view

농업의 기원은 진화론적 장구한 연대를 부정한다. : 30만 년 전에 출현한 현대 인류가 1만 년 전에 농업을 시작?

http://www.kacr.or.kr/library/itemview.asp?no=6856

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다? 

http://www.creation.or.kr/library/itemview.asp?no=6292


출처 : ICR, 2020. 6. 28.

주소 : https://www.icr.org/article/humans-neanderthals-more-similar-polar-brown-bears/

번역 : 미디어위원회

   



미디어위원회
2020-05-21

인간의 2번 염색체에서 융합은 결코 일어나지 않았다.

: 사람과 원숭이류의 염색체 수 차이에 대한 진화론적 설명의 실패 

(Human Chromosome 2 Fusion Never Happened)

by Jeffrey P. Tomkins, PH.D.


      인간이 유인원(apes, 꼬리없는 원숭이류)에서 진화했다고 추정하는데 가장 많이 사용되는 주장 중 하나는 염색체 융합(chromosome fusion)으로 알려진 것이다. 이 개념이 생겨나게 된 이유는 유인원은 인간보다 염색체 한 쌍을 더 갖고 있기 때문이다. 즉 인간은 46개의 염색체를, 유인원은 48개의 염색체를 갖고 있는데, 이는 진화론의 심각한 문제가 되고 있다. 인간이 유인원 같은 생물체로부터 300~600만 년 전에 진화했다면, 이러한 거대한 변화는 짧은 시간 내에 빠르게 일어나야만 했다. 왜 인간과 유인원은 이러한 거대한 차이를 갖고 있는 것일까?

진화론적 해결책은 유인원의 작은 두 염색체(2A와 2B라는 이름의 염색체)의 양 끝이 융합되어(end-to-end fusion)이 인간의 2번염색체가 됐다는 것이다.(그림 1). 이러한 융합 개념은 과학자들이 현미경으로 인간 염색체와 유인원 염색체의 유사성을 조사했던 1982년에 처음 시작되었다. 이러한 전략은 처음에는 다소 조잡했지만, 진화론적 문제점을 해결해주기에 충분했다.[1]


소위 말해지는 융합 부위

융합이 일어났을 가능성에 대한 최초 DNA 상의 서명(DNA signature)은 1991년 인간의 2번염색체에서 발견되었다고 주장되었다.[2] 연구자들은 애매하게 융합 가능성을 닮은, 텔로미어 같은(telomere-like) 말단 염기서열의 작은 뒤죽박죽된 다발(cluster)을 발견했다. 텔로미어는 염색체 끝에서 반복적으로 나타나는, 6개의 특정 DNA 철자의 염기서열(TTAGGG)을 일컫는다.

그림 1. 침팬지의 2A와 2B 염색체가 엔드-투-엔드 융합(end-to-end fusion)되어 인간 2번 염색체가 되었다는 가설 모델. 그림은 유니스(Yunis)와 프라카시(Prakash)의 논문에서 세포 유전학적 이미지로 그려진 것을 인용함. 이미 알려진 인간 2번염색체의 크기에 기초하여 볼 때, 유인원과 약 10%가 즉 2,400만 개의 염기(bases)가 다르다는 것을 알 수 있다.

 

그러나 이 융합되었다는 서명(fusion signature)은 때때로 자연에서 발생하는 실제 융합과 비교해보면, 다소 수수께끼의 사건이다. 살아있는 동물에서 모든 융합의 기록은 염색체에 위치해있는, 염색체의 파손 및 융합 시에 함께 발견되는, 위성 DNA(satellite DNA, satDNA)라 불리는 한 특별한 염기서열에 들어있다.[3~5] 그러나 인간 2번염색체의 융합 서명은 이것을 표시해주는 위성 DNA(satellite DNA)에 존재하지 않는다(잃어버렸다).[6]

또 다른 어려움은 융합 부위의 작은 크기이다. 이곳은 단지 798개의 염기(철자) 길이를 갖고 있을 뿐이다. 그러나 염색체 말단에 있는 텔로미어의 크기는 5,000에서 15,000개의 염기 길이를 갖고 있다. 만약 두 개의 염색체가 융합되었다면, 길이가 798개가 아니라, 이보다 훨씬 많은 10,000에서 30,000개의 융합된 텔로미어 서명을 볼 수 있어야 한다.

진화론자들이 주장하는 융합 이야기에서, 작은 크기는 하나의 문제일 뿐만 아니라, 그들이 잘려져서 서로 융합되었다는 실제적 서명이 텔로미어에 존재하지 않는다는 것이다. 그림 2는 굵은 글씨로 강조된, 6개 염기(bases, DNA 글자)의 온전한 텔로미어 염기서열을 갖고 있는, 798개의 DNA 염기(글자)들을 보여준다. 이들 융합 염기서열을 동일한 크기의 본래의 융합 서명과 비교했을 때, 전체적으로 단지 70% 정도만 동일하다.

그림 2. 주장되는 융합 부위의 798개 염기서열. 온전한 순방향 텔로미어(TTAGGG) 및 역방향 텔로미어(CCCTAA)의 염기서열은 굵은 글꼴로 표시되었다. 실제로 융합 지점이라고 주장되는 염기서열(AA)은 밑줄로 표시되었다.


세속적 연구자들은 이러한 불일치에 대해서 융합 부위가 상당히 "퇴화되었다"고 주장했다.[7] 인간 진화론의 표준 모델에 의하면, 인간과 유인원은 70%가 아니라, 약 98~99%가 동일해야 한다. 이 발견을 기술했던 연구자들은 “융합 부위에서 반복되는 헤드-투-헤드(head-to-head) 배열은, 텔로미어에서 발견되는 거의 완벽한 (TTAGGG)n 배열보다 현저하게 퇴화되었다”고 말했다. 그러면서 이렇게 묻고 있었다. “만약 융합이 6백만 년 내에 텔로미어의 반복적 배열 안에서 일어났다면, 왜 융합 부위의 배열은 그렇게 퇴화했던 것일까?”[7] 저자들이 말하는 14%의 퇴화는 전체 798개 염기에 대한 것이 아니라, 단지 6개의 염기서열 자체의 손상에 대한 것이다.


유전자 안쪽의 융합 부위?

융합 부위(fusion site)에 대한 진화론적 주장을 기각시키는 가장 주목할만한 발견은, 그 위치에 관한 것으로, 그 부위가 실제로 무슨 일을 하고 있는지가 밝혀진 것이다. 이 발견은 주장되는 융합 부위를 둘러싼 614,000개의 DNA 염기서열에 대한 상세한 분석 보고서를 읽는 동안에 알게 됐다. 나는 융합 지점이 한 유전자의 안쪽(inside)에 위치한다는 그림 중 하나를 주목했는데, 그 논문의 본문에서는 이러한 매우 이상한 점이 거론되지 않고 있었다.[8]

이 발견은 매우 주목할 만한 것이다. 아마도 이 정보는 유전자가 융합되었다는 진화론적 관점에 철퇴를 가하는 일일 것이다. 그래서 이들 연구자들은 그 정보에 대해 논의하지 않았던 것으로 보인다. 이 주요한 이상(anomaly)은 나에게 융합 지점에 대해 훨씬 더 자세한 조사를 하도록 영감을 주었다. 이 논문은 2002년에 발간되었으며, 나는 이 논문을 2013년에 조사하여 보았는데, 인간 유전체의 구조와 기능에 관한 방대한 양의 데이터가 그 이후에 알려지게 되었고, 그 당시 발견되지 않았던, 많은 사실들이 밝혀졌기 때문이다.

추가 연구를 수행한 결과, 융합 부위는 DDX11L2라 불리는 RNA 헬리카제 유전자(RNA helicase gene)의 안쪽에 위치하고 있음을 확인했다. 식물과 동물의 대부분의 유전자들은 엑손(exon)이라고 불리는 그들의 코딩 분절(coding segments)을 조각으로 갖고 있다. 따라서 그들은 선택적으로 접합(alternatively spliced)될 수 있다. 엑손의 첨가 또는 배제에 기초하여, 유전자는 다양한 생성물을 만들 수 있다. 엑손 사이의 중간 영역은 인트론(introns)이라고 하며, 종종 유전자 기능을 제어하는 다양한 신호 및 스위치를 포함하고 있다. 주장되는 융합 부위는 DDX11L2 유전자의 첫 번째 인트론 안쪽에 위치한다.(그림 3).[9]

그림 3. DDX11L2 유전자의 첫 번째 인트론 안쪽(inside)에 주장되는 융합 지점의 단순화된 그림. 또한 그래픽은 전사인자(transcription factor)의 결합 부위와 함께, 생성된 짧거나 긴 전사변이체(transcript variants)의 두 가지 버전을 보여준다. 첫 번째 엑손의 화살표는 전사 방향을 나타낸다.

 

DNA 분자는 플러스 가닥과 마이너스 가닥으로 된, 이중가닥이다. 유전자는 효율성과 기능성을 향상시키면서, 정보밀도를 최대화하도록 이러한 방식으로 설계되었다. 결과적으로, 반대 가닥에서 다른 방향으로 진행되는 유전자가 있다. 밝혀진 것처럼, DDX11L2 유전자는 마이너스 가닥 위에 인코딩되어 있다. 인간의 유전자는 스위스제 군용 칼처럼 다양한 RNA들을 생산할 수 있기 때문에, DDX11L2 유전자의 경우, 2개의 엑손으로 구성된 짧은 변이체와, 3개의 엑손으로 구성된 긴 변이체를 만든다.(그림 3).[9]


융합 부위는 한 촉진유전자이다.

이 DDX11L2 유전자는 무슨 일을 하고 있을까? 내 연구에 따르면, 이 유전자는 255가지 이상의 다른 세포 또는 조직 유형에서 발현되는 것으로 나타났다.[9] 또한 다양한 다른 유전자와 함께 세포에서 동시에 발현되고, 세포외기질과 혈액에서 세포 신호와 연관된 과정과도 연결되어 있다. 소위 융합 부위라는 염기서열의 위치가 다양한 세포 과정의 유전학과 연관된 기능성 유전자 안쪽에 위치한다는 것은, 그 유전자가 우연히 텔로미어의 헤드-투-헤드(head-to-head)의 융합으로 생겨난 부산물이라는 생각을 강력하게 반박하는 것이다. 유전자는 파국적인 염색체 융합으로 형성되지 않았다!

더욱 놀라운 것은 융합 지점 자체가 기능적이며, 중요한 공학적 목적을 수행하고 있다는 사실이다. 이 지점은 실제로 유전자 활동을 제어하기 위한, 일종의 스위치 역할을 수행하고 있다. 이와 관련하여, 풍부한 생화학적 데이터는 전사인자라 불리는 12개의 다른 단백질들이 이 유전자 부분을 조절한다는 것을 보여주었다. 이들 중 하나는 다름아닌 RNA 중합효소 II(RNA polymerase II)라는 것인데, DNA로부터 RNA 분자를 복사하는, 전사(transcription)라 불리는 과정에 관여하는 주요 효소이다. 이 발견을 더욱 뒷받침하는 것은, 실제 전사과정은 소위 융합 부위라고 말해지는 부위 내에서 시작된다는 사실이다.

주장되는 융합 부위는 전문적 용어로 촉진유전자(promoter) 부위라고 불려지는 곳이다. 촉진유전자는 유전자의 활성을 시작시키는 주요한 스위치이며, 또한 RNA 중합효소들이 RNA를 만드는 과정을 시작하도록 한다. 많은 유전자에는 DDX11L2 유전자와 같은 대체 촉진유전자(alternative promoters)들이 있다.

실제로 DDX11L2 유전자에는 전사인자가 결합하는 두 부위가 있다. 하나는 첫 번째 엑손 바로 앞의 촉진유전자에서 결합하거나, 다른 하나는 융합 지점의 염기서열에 해당하는 첫 번째 인트론에서이다. DDX11L2 유전자 자체가 복잡하게 제어될 뿐만 아니라, 주장되는 융합 부위의 염기서열은 매우 중요한 역할을 하고 있으며, 만들어진 RNA 전사체(transcripts)도 매우 복잡하다. RNA 자체도 매우 다양한 결합을 하고 있고, microRNA라 불리는 다수의 작은 조절인자들에 대한 위치도 제어하고 있다.[9]


말단이 아니라 안쪽에 있는, 기능적 텔로미어 염기서열은 유전체 전체에 걸쳐 있다.

안쪽에 위치한 텔로미어 염기서열의 존재는 인간 유전체 전체에서 발견된다. 잘못된 위치에 있는 것처럼 보이는, 이들 텔로미어의 반복은 간질성 텔로미어(interstitial telomeres)라는 별칭을 갖고 있다. 이들 염기서열의 존재는 융합 부위에 대한 또 다른 문제점이 되고 있다. 융합 부위에서 텔로미어 반복(telomere repeats)이 나란히 일어나있는 일은 극히 드물다. 그림 2에서 알 수 있듯이 798개 염기의 융합 부위에는 단지 두 번의 반복이 일어나 있고, 세 번이나 그 이상의 반복은 없다. 그러나 인간 유전체의 전체에 걸쳐 있는 많은 간질성 텔로미어에는 반복이 3~10번 또는 그 이상으로 나란히 발생해 있다.[10, 11]

염색체 말단에서의 역할 외에도, 간질성 텔로미어의 반복은 유전체에서 유전자 발현과 관련된 중요한 기능을 하는 것으로 보인다. 최근의 한 연구 프로젝트에서, 나는 인간 유전체 전체에 걸쳐서 텔로미어가 반복되고 있는 것을 확인했고, 유전자 활성에 대한 기능적 생화학적 정보를 포함하는 다양한 데이터 세트와 그들의 유전체 위치를 교차한다는 것을 확인했다.[12] 사실상 유전체를 가로지르는 수천 개의 내부 텔로미어 반복이 유전자 발현의 특징과 직접적으로 관련되어 있었다. 또한 융합 부위로 주장되는 곳에서 발생하는 동일한 유형의 전사인자 결합 및 유전자 활성은, 유전체 전체에서 다수의 다른 간질성 텔로미어 반복이 있는 곳에서 발생하고 있었다. 분명히, 이러한 DNA 특성은 무작위적으로 우연히 일어난 결과가 아니라, 의도적이고 지능적으로, 설계된 기능적 코드임을 가리킨다.


유전자 안쪽에 숨겨진 동원체는 없다.

융합 모델의 또 다른 주요한 문제점은 추가된 (또 하나의) 동원체 부위(extra centromere region)에 대한 명확한 증거가 없다는 것이다. 동원체(centromeres, 중심절, 한 쌍의 자매 염색체를 연결하는 중심 부분)는 종종 염색체 중앙에 위치하며, 세포분열 동안 주요 역할을 담당하는 부분이다. 그림 1에서 볼 수 있듯이, 융합되어 새로 형성되었을 것으로 상상되는 괴물 염색체(chimeric chromosome)는 주장되는 두 염색체의 헤드-투-헤드 융합이 일어난 직후에, 두 개의 동원체가 있었을 것이다. 이 경우에, 동원체 중 하나는 작동되고 다른 하나는 작동되지 않았을 것이다. 두 개의 작동되는 중심절(동원체)이 존재했다면, 이는 염색체에게 나쁜 소식이며, 기능 장애 및 세포 파괴로 이어질 수 있다.

흥미롭게도, 인간의 2번염색체에 숨겨진 동원체(cryptic (disabled) centromere)가 있었다는 증거는 결여되어 있다. 이에 대한 증거는 융합 부위에 풍부한 텔로미어가 있어야하는 증거보다 훨씬 더 빈약하다. 진화론자들은 (융합 후의) 두 번째 동원체가 빠르게 선택적으로 퇴화되었을 것이라고 주장함으로써, 명확하게 구별되지 않는 비기능적인 두 번째 동원체의 결여를 설명하고 있다. 가상의 융합 후, 비기능적 동원체는 유전체에서 유용한 무언가를 하면서 남아있을 수 없었기 때문에, 시간이 지남에 따라 퇴화되었다는 것이다.

그러나 염기서열 퇴화의 어떤 단계를 나타내는 두 번째(추가된) 동원체의 잔재물에 대한 증거가 결여되어 있다는 것은 진화론적 융합 모델에 문제가 되고 있다. 기능적인 동원체 염기서열은 알포이드 서열(alphoid sequences)이라 불리는, 반복적인 유형의 DNA로 구성되어 있다. 그리고 각각의 알포이드 반복(alphoid repeat)은 길이 약 171개 염기로 되어있다. 일부 유형의 알포이드 반복은 유전체 전체에서 발견되는 반면, 다른 유형은 동원체에서만 발견된다. 인간 2번염색체의 숨겨진 동원체에서 발견되는 염기서열의 구조는, 인간의 기능적인 동원체와 관련된 염기서열과 일치하지 않는다.[13] 진화 모델에서 더욱 불리한 것은, 침팬지 유전체에는 이것과 유사한 대응부분(counterparts)이 없다는 것이다. 그것은 인간에게서만 특별하게 존재한다.[13]

또한 퇴화됐다고 주장되는 화석 동원체는 실제의 동원체와 비교할 때 매우 작다. 정상적인 인간 동원체의 크기는 250,000~5,000,000 염기 길이이다.[14] 주장되는 숨겨진 동원체(cryptic centromere)는 단지 41,608 염기의 길이에 불과하고, 또한 알포이드 반복조차도 없는 세 다른 부위에 있다는 점도 중요하다.[15] 이들 중 2개는 역인자(retroelements)라 불리며, 그 중 하나인 LPA3/LINE 인자는 길이가 5,957개 염기이고, 다른 하나는 2,571개 염기의 SVA-E 인자이다. 이러한 비-알포이드 염기서열의 삽입을 빼면, 실제 동원체의 길이는 단지 33,080개 염기에 불과하다.

그리고 화석 동원체라는 아이디어에서 가장 심각한 진화론적 문제는 융합 부위라고 알려진 곳이 기능성 유전자 안쪽에 위치한다는 것이다. 숨겨진 동원체(cryptic centromere)는 ANKRD30BL 유전자 내부(안쪽)에 위치하며, 그 염기서열은 유전자의 인트론과 엑손 영역 모두에 걸쳐 있다.[12, 15]

실제로, 엑손 안쪽에 위치하는 화석 동원체 염기서열의 일부는 실제로 유전자에서 단백질을 만드는 아미노산에 대한 암호가 코딩되어 있는 곳이다. 이 유전자는 세포막에 내장된 수용체 단백질과 관련하여, 세포골격 단백질(cytoskeleton)이라 불리는 세포 내의 단백질의 구조 네트워크의 상호작용에 관여하는 단백질들을 만들고 있다.[16] 소위 화석 또는 숨겨진 동원체가 중요한 단백질을 코딩하는 유전자의 기능적 영역이라는 사실은, 그것이 쇠퇴(퇴화)된 동원체라는 생각을 완전히 반박한다.


결론 : 융합은 없었다.

주장되는 융합 부위에 서명이 없고, 화석 동원체의 작은 크기 등에 의하면, 그 염기서열이 고대에 두 염색체가 융합되어 유래됐다는 진화론자들의 주장은 매우 의심스러운 것이다. 이뿐만 아니라, 그 부위는 유전자 안쪽의 기능적 염기서열이 있는 곳에 위치하고 있다. 주장되는 융합 부위는 DDX11L2 라는 긴 비코딩 RNA 유전자 안쪽의 촉진유전자라 불리는 한 중요한 유전자의 스위치가 있는 곳이다. 그리고 소위 화석 동원체 부위는 커다란 안키린(ankyrin) 반복 단백질-코딩 유전자 안쪽의 코딩 및 비코딩 염기서열 모두가 있는 곳이다.

이것은 두 염색체가 융합되었다는 생각이 완전히 신화에 불과하다는, 부정하기 어려운 이중의 재난(double whammy)이며, 그 유효성을 완전히 파괴하는 것이다. 압도적인 과학적 결론은 ‘융합은 결코 일어나지 않았다’는 것이다.


References

  1. Yunis, J. J. and O. Prakash. 1982. The origin of man: a chromosomal pictorial legacy. Science. 215 (4539): 1525-1530.
  2. Ijdo, J. W. et al. 1991. Origin of human chromosome 2: An ancestral telomere–telomere fusion. Proceedings of the National Academy of Sciences. 88 (20): 9051-9055.
  3. Chaves, R. et al. 2003. Molecular cytogenetic analysis and centromeric satellite organization of a novel 8;11 translocation in sheep: a possible intermediate in biarmed chromosome evolution. Mammalian Genome. 14 (10): 706-710.
  4. Tsipouri, V. et al. 2008. Comparative sequence analyses reveal sites of ancestral chromosomal fusions in the Indian muntjac genome. Genome Biology. 9 (10): R155.
  5. Adega, F., H. Guedes-Pinto, and R. Chaves. 2009. Satellite DNA in the Karyotype Evolution of Domestic Animals—Clinical Considerations. Cytogenetic and Genome Research. 126 (1-2): 12-20.
  6. Tomkins, J. P. and J. Bergman. 2011. Telomeres: implications for aging and evidence for intelligent design. Journal of Creation. 25 (1): 86-97.
  7. Fan, Y. et al. 2002. Genomic Structure and Evolution of the Ancestral Chromosome Fusion Site in 2q13–2q14.1 and Paralogous Regions on Other Human Chromosomes. Genome Research. 12 (11): 1651-1662.
  8. Fan, Y. et al. 2002. Gene Content and Function of the Ancestral Chromosome Fusion Site in Human Chromosome 2q13–2q14.1 and Paralogous RegionsGenome Research. 12 (11): 1663-1672.
  9. Tomkins, J. P. 2013. Alleged Human Chromosome 2 “Fusion Site” Encodes an Active DNA Binding Domain Inside a Complex and Highly Expressed Gene—Negating Fusion. Answers Research Journal. 6: 367-375.
  10. Azzalin, C. M., S. G. Nergadze, and E. Giulotto. 2001. Human intrachromosomal telomeric-like repeats: sequence organization and mechanisms of origin. Chromosoma. 110: 75-82.
  11. Ruiz-Herrera, A. et al. 2008. Telomeric repeats far from the ends: mechanisms of origin and role in evolution. Cytogenetic and Genome Research. 122 (3-4): 219-228.
  12. Tomkins, J. P. 2018. Combinatorial genomic data refute the human chromosome 2 evolutionary fusion and build a model of functional design for interstitial telomeric repeats. In Proceedings of the Eighth International Conference on Creationism. J. H. Whitmore, ed. Pittsburgh, PA: Creation Science Fellowship, 222-228.
  13. Tomkins, J. and J. Bergman. 2011. The chromosome 2 fusion model of human evolution—part 2: re-analysis of the genomic data. Journal of Creation. 25 (2): 111-117.
  14. Aldrup-Macdonald, M. E. and B. A. Sullivan. 2014. The Past, Present, and Future of Human Centromere GenomicsGenes (Basel). 5 (1): 33-50.
  15. Tomkins, J. P. 2017. Debunking the Debunkers: A Response to Criticism and Obfuscation Regarding Refutation of the Human Chromosome 2 Fusion. Answers Research Journal. 10: 45-54.
  16. Voronin, D. A. and E. V. Kiseleva. 2008. Functional Role of Proteins Containing Ankyrin Repeats. Cell and Tissue Biology. 49 (12): 989-999.

* Dr. Tomkins is Life Sciences Director at the Institute for Creation Research and earned his Ph.D. in genetics from Clemson University.

* Cite this article: Jeffrey P. Tomkins, Ph.D. 2020. Human Chromosome 2 Fusion Never Happened. Acts & Facts. 49 (5).


*참조 : 내부 텔로미어로 보이는 염기서열은 풍부하고 기능적이다. 

http://creation.kr/IntelligentDesign/?idx=1291767&bmode=view

사람과 침팬지의 DNA 유사성이 98% 이상인가? 그렇지 않다

http://creation.kr/Variation/?idx=1290341&bmode=view

보노보 유전체 해독에서 반-진화론적 비밀 : 유사한 영역만 비교하여 98.7%가 유사하다?

http://creation.kr/Apes/?idx=1852163&bmode=view

사람과 원숭이의 유전자 차이는 이전 보고의 4배

http://creation.kr/Mutation/?idx=1289754&bmode=view

사람과 침팬지 사이의 유전적 차이가 재계산되었다. 

http://creation.kr/Apes/?idx=1852205&bmode=view

1%의 신화 : 인간과 침팬지의 DNA는 매우 다르다.

http://creation.kr/Apes/?idx=1852185&bmode=view

사람과 침팬지의 Y 염색체 차이는 30% 이상이었다. 

http://creation.kr/Apes/?idx=1852097&bmode=view

진화론자들의 Y 염색체 충격 : 침팬지와 사람의 Y 염색체는 ‘끔찍하게’ 달랐다.

http://creation.kr/IntelligentDesign/?idx=1291705&bmode=view

사람과 침팬지의 DNA가 유사하다면, 왜 그렇게 많은 육체적 정신적 차이가 있는가?

http://creation.kr/Variation/?idx=1290374&bmode=view

사람과 침팬지의 DNA는 완전히 달랐다.

http://creation.kr/IntelligentDesign/?idx=1291692&bmode=view

사람 lincRNA 유전자는 진화론을 부정한다. : 침팬지의 lincRNA와 차이는 20% 이상이었다.

http://creation.kr/IntelligentDesign/?idx=1291733&bmode=view

또 하나의 진화론적 상징물이 무너졌다 : 진화론자들도 인간과 침팬지 DNA의 99%가 유사하다는 생각을 단념하다

http://creation.kr/Apes/?idx=1852048&bmode=view

Alleged Human Chromosome 2 “Fusion Site” Encodes an Active DNA Binding Domain Inside a Complex and Highly Expressed Gene—Negating Fusion.

https://answersingenesis.org/genetics/dna-similarities/alleged-human-chromosome-2-fusion-site-encodes-an-active-dna-binding-domain-inside-a-complex-and-hig/

COMBINATORIAL GENOMIC DATA REFUTE THE HUMAN CHROMOSOME 2 EVOLUTIONARY FUSION AND BUILD A MODEL OF FUNCTIONAL DESIGN FOR INTERSTITIAL TELOMERIC REPEATS.

http://creationicc.org/2018_papers/22 Tomkins Chromosome 2 final.pdf

Comprehensive Analysis of Chimpanzee and Human Chromosomes Reveals Average DNA Similarity of 70%

https://answersingenesis.org/answers/research-journal/v6/comprehensive-analysis-of-chimpanzee-and-human-chromosomes/


출처 : ICR, 2020. 4. 30.

주소 : https://www.icr.org/article/human-chromosome-2-fusion-never-happened/

번역 : 미디어위원회







미디어위원회
2020-04-06

벼랑 끝에 선 인류의 ‘아프리카 기원설’

: 선호되던 인간 진화 이야기는 이제 고군분투하고 있다.

(‘Out of Africa’ on the ropes

The favoured story of evolution is now struggling)

by Peter Line


      미국 자연사박물관(National Museum of American Natural History)을 방문하는 대부분의 사람들은 '인류 가계도(Family Tree)' 전시를 포함하여(그림 1), 인간 이전의 '유인원'(일명 'hominins' 또는 'hominids')들을 경외심을 갖고 보게 된다. 두개골 모형을 사용하여, 그들은 선재(先在)한 인간들 사이의 진화론적 관계를 보여준다. 사람이 진화한 원숭이에 불과하다는 것을 의심하는 사람들은 일종의 큰 펀치를 맞게 되는 것이다.

그림 1 : 뉴욕의 미국 자연사박물관의 앤 & 버나드 스피처 인류기원관(Anne and Bernard Spitzer Hall of Human Origins)에 전시된 “인류 진화 계통도”


창조(Creation) 지는 여러 박물관, 교육기관, 언론매체 등의 모든 과대선전에도 불구하고, 인간 진화 이야기는 그리 믿을 만한 것이 아니라고 주장해왔었다.[1] 사실 인간 진화론은 진화론자들을 당황시키고 있는, 극복할 수 없는 생물학적 장벽에 직면해 있다. 이 글은 인간과 침팬지가 동일한 공통조상으로부터 진화하는 데에 필요한 6백만 년이라는 세월도 돌연변이에 의한 종의 변화를 일으키는 데는 너무도 적은 시간이라는 것을 보여준다.

두개골 화석의 '연대측정'도 혼란에 빠져있다. 한때 거의 확실하다고 주장되던 것들도 이후에 종종 폐기되었다. 진화론자들은 계속해서 어려움을 겪고 있으며, 그들의 주장은 반복적으로 ‘미봉책(patched up)’이 되어, 차후에 새로운 대안이 나와 포기될 때까지 기다리는 것처럼 보인다. 여기에서 언급할 인간 진화의 ‘아프리카 기원설’도 그중에 하나이다.


아프리카 기원설이 재고되고 있다.

인간 진화론의 선도적 주장은 '아프리카 기원설'로 ‘탈아프리카 모델’(Out of Africa Model, OoAM), 종종 ‘아프리카인 교체 모델(African replacement model)’이라 불리는 것이다.[2] ‘탈아프리카 모델(OoAM)’에 의하면. 현생인류(Homo sapiens, 호모 사피엔스)는 동아프리카에서 진화하여 출현했으며, 이는 단지 20만 년 전이라고 주장한다.[3]

(*참고 : 여기에서 말해지는 오래된 ‘연대’에 대한 비판은 새로운 모델을 적절하게 설명하기 위한 것으로, 저자들이 주장하는 연대는 진화론 내에서 이루어지는 것이며, 약 6천 년의 성경적 창조 연대를 지지하는 것이 아니다.) 

이들 현생인류는 전 세계로 퍼져 나갔다. 이스라엘에서 일시적으로 거주했던 것으로 생각되지만, 아마도 12만 년 전 정도의 최근에 시작했을 수도 있다.[4] 인류가 아프리카로부터 주로 나오기 시작한 것은 약 7만 년 전으로 본다.[4] 이 현생인류는 아마도 아시아, 유럽 및 다른 구세계 전역으로 퍼져나갔으며, “네안데르탈인과 같은 덜 진화된 사람들”을 교체했다고 주장한다.[5] 교체 시에 이들 간에 교잡(interbreeding)은 거의 없었거나, 전혀 없었던 것으로 말해져왔다.[2]

            화석 두개골의 해석과 '연대'는 혼란에 빠졌다. 한때 거의 확실하다고 선포됐던 주장들이 후에 종종 폐기되었다. 

탈아프리카 모델의 주요한 진화론적 대안은 오랫동안 '다지역 기원설(multiregionalism)'이었다. 다지역 기원설은 오늘날 다양한 인류 집단의 고대 조상은 거의 2백만 년 전에 아프리카에서 이주해왔던 인간(Homo erectus)이라고 주장한다.[6] 그들은 대략 오늘날 있는 곳인 서로 다른 지역에서 지금의 현생인류로 각각 진화하여 살아왔다는 것이다. 이 모델은 “교잡(이종교배)을 통한 그룹 간의 유전자 흐름은 중요한 변화를 확산시켰고, 인간을 단일 종으로 유지하기에 충분했다”고 주장한다.[6]


비틀거리는 아프리카 기원설

한때 주도적 이론이었던 ‘탈아프리카 모델’은 최근 어려운 시기를 맞이하고 있다. 먼저 고대 DNA 증거를 통해서, 탈아프리카 모델에서 제안됐던 그룹 간 교잡이 거의 없었을 것이라는 주장은 사실이 아님이 밝혀진 것이다. 이것은 네안데르탈인, 미스터리한 데니소바인과 같은 다른 인간 집단과 현생인류 사이의 교잡(이종교배)이 상당히 빈번하게 반복적인 이루어졌음을 나타내며, 결국 그들은 동일한 종(species)임을 의미하는 것이다.[7]


‘연대’ 혼란

그리고 진화론적 연대로 12만4천 년 전의 네안데르탈인 대퇴골에서 채취된 미토콘드리아 DNA(mtDNA)에 대한 2017년 연구에 의하면, 아프리카인의 mtDNA 유전자들이 27만 년 전에 네안데르탈인 안으로 유입되었다는 것이다.[8] 진화론적 관점에서 볼 때, 이것은 초기 현생인류가 아프리카를 떠나기 오래 전부터, 그들이 진화했었다는 장소인 유럽 내에 또는 근처 지역에, 이미 존재하고 있었다는 것이다! 

*관련기사 : 호모 사피엔스, 22만년 전에 유럽으로 왔다. (2017. 7. 5. 조선비즈)

https://biz.chosun.com/site/data/html_dir/2017/07/14/2017071401710.html

같은 해, 모로코의 제벨 이르후드(Jebel Irhoud)에서 발견된 한 호모 사피엔스(Homo sapiens)의 두개골 화석(그림 2는 상자 안에 있음)은 약 16만 년 전보다 훨씬 이전인, 31만 5천 년 전으로 다시 연대가 수정되었다. 진화론적 관점에서 볼 때, 이것은 그들이 믿고 있었던 동아프리카가 아닌, 북아프리카에서, 생각보다 10만 년이나 앞서서 현생인류가 등장했다는 것을 의미한다.

*관련기사 : 30만년 전 호모사피엔스 화석 찾았다…종전보다 10만년 앞서(2017. 6. 8, 연합뉴스)

https://www.yna.co.kr/view/AKR20170608086500017

이로 인해 야벨 이루흐드 두개골과 중국의 달리(Dali) 두개골(~ 26만 년 전)의 유사점을 발견한 다른 연구자들은 “호모 사피엔스(H. sapiens)와 관련된 특징들이 동아시아에서 진화하여 아프리카로 옮겨졌을 수도 있다”고 제안했다. 이것은 인류의 기원이 아프리카 기원설이 말하는 것처럼 아프리카에만 국한된 것이 아니라는 것을 의미한다.[11]

최근 호모 사피엔스와 일치하는 특징을 가진, 이스라엘의 미스리아 동굴(Misliya Cave)에서 발견한 상악골(upper jawbone)은 17만7천~19만4천 년으로 연대가 평가되었는데, 이것은 “일련의 호모 사피엔스 가계들이 이전에 생각했던 것보다 일찍 아프리카를 떠났다는 것을 의미한다.”[12] 이전에는 아프리카 외부에서 발견된 가장 초기의 현생인류 화석은 이스라엘의 스쿨(Skhul)과 카프제(Qafzeh)에서 발견된 9만~12만 년 전으로 주장되던 것이었다.[12]


모래 위의 인간 진화론

그렇다면 자신들의 데이터에 의해서도 스스로 부정되고 있는 탈아프리카 모델을 진화론자들이 버릴 것인가? 그렇지는 않을 것 같다. 단지 그들은 “우리 종이 어떻게 출현했는지 근본적으로 재고할 필요가 있다”는 점을 인정하면서도, 최근의 발견들을 새로운 '진화하는' 이야기에 적합시키려고 시도하고 있다.[13]

다양한 형태의 다지역 기원설들이 여러 단계로 다시 제안되고 있었다. 23명의 진화론자들로 구성된 한 컨소시엄은 최근에 '아프리카 다지역 기원설(African multiregionalism)'이라는 이름의 모델을 주장하는 논문에 이름을 올렸다.[14] 세리(Scerri et al.) 등에 의하면, “새로운 데이터는 다양한 원시적인 특징의 얼굴을 가진 다양한 과도기적인 인간 집단이 30만 년 이상 전에서 1만2천 년 전 사이에 모로코에서 남아프리카에 이르는 광범위한 지역에 살았을 수도 있었다고 제안했다.”[15] 이들은 현생인류의 아프리카 기원을 포기하지 않으면서, 아프리카 전역에 걸친 모호한 버전의 다지역 기원설을 제안하고 있었다. 케이트 왕(Kate Wong)은 그들의 입장을 아래와 같이 요약하고 있었다 : 

현생인류는 아프리카의 특정한 지역에서 소집단으로 진화했다기보다는, 사막과 같은 생태학적 장벽과 거리상의 문제로 수천 년 동안 반쯤 격리된 상태로 존재했던, 광대한 아프리카 대륙을 가로지르며 소그룹으로 나뉘어져 분포했던 한 큰 집단에서 유래했다고, 그들은 제안한다.[16] 


모델을 고르라!

헨(Henn et al.) 등은 최근 ‘아프리카 다지역 기원설’을 포함하여, 호모 사피엔스의 아프리카 기원에 대한 네 가지 가능한 모델을 소개하고 있었다.[17] '잡동사니(smorgasbord) 모델'이 있다는 것은 상당한 불확실성을 가리키는 것이며, 아프리카 기원설 자체에 의문을 제기하는 것이다.

다른 진화론자들은 다시 한 번 글로벌 다지역 기원설에 기울고 있다. 새롭게 발견된 화석들이 아프리카 기원설을 뒤집고 있는 것에 대해, 인류학자인 쉴라 아트레야(Sheela Athreya)는 다음과 같이 말했다 :

여러 새로운 발견들로 인해서, 연구자들과 뉴스 헤드라인들은 화석들은 인류 진화와 아프리카 기원에 대한 우리의 이해를 크게 바꾸었다고 발표했다. 그러나 우리가 현생인류(H. sapiens)의 진화 이야기를 너무 자주 다시 써야 한다면, 우리가 사용하고 있는 전제가 처음부터 잘못되었는지 물어보아야만 할 것이다.[18]

아트레야는 현재 인도의 빔베카(Bhimbetka)에서 진행되고 있는 연구에 참여하고 있는데, 그들은 현재와 과거에 살았던 사람들의 관련성에 중점을 두고, "진화 이야기를 보다 포괄적으로 만드는 것"을 추구하고 있었다.[18] 그녀는 특히 남아시아에서 지역간 연속성(다지역 기원설)을 고려하고 있는 것으로 보인다.

               우리가 갖고 있는 증거는 사람, 유인원, 오스트랄로피테신(지금은 멸종한) 내에 다양한 

               생물학적 변이(variation)가 오랫동안 존재했음을 나타낸다.


‘모호함’ - 새로운 표준?

진화 인류학자인 이상희(Sang-Hee Lee)는 썼다 :

새로운 연구와 새로운 세대의 연구자들은 이 학문의 중심에 있는 이러한 전제들에 도전하고 있으며, 증거들은 현생인류가 하나의 기원을 갖고 있지 않음을 가리키고 있다. 대신, 기원의 경계는 모호하고, 때론 혼란스러움을 본다. 이러한 말들은 선명하지는 않지만, 인간 진화의 진정한 이야기에 우리를 더 가깝게 다가가도록 해주고 있는 것으로 보인다.[19]

이상희는 세계적 다지역 기원설을 채택한 것으로 보인다 : “현생인류는 한 분리된 종에서 생겨난 것이 아닌, 고유의 개체군으로 연속성을 갖으며, 서로 다른 시간과 다른 장소들에서 생겨났다.”[19] 

새로운 발견들은 경멸되어왔던 다지역 기원설 모델을 다시 기꺼이 받아들이도록 만들었다. 그리고 대륙적(아프리카) 다지역 기원이든, 전 세계적 다지역 기원이든 그 둘 모두를, 이제는 진화론자들에 의해 일반적으로 폐기된 것으로 간주되고 있는, 적어도 엄격해진 버전의 탈아프리카 모델과 함께, 받아들이고 있다는 것은 아이러니한 상황이다.[20]


결론

세계적 다지역 기원설(global multiregionalism)은 탈아프리카 모델보다 더 신뢰할만해 보이지 않는다. 진화론적 관점에서조차, 거의 2백만 년 동안 여러 대륙에 걸쳐 작게 흩어져있는 호모 에렉투스 소집단 사이의 유전자 교환이 그들을 모두를 하나의 단일 종으로 유지하는 데는 도움이 되었을 것이라는 주장은, 그러면서 같은 시기에 그들 주변에 도착했던 다른 개체군들은 개별적으로 현생인류의 해부학적 형태로 진화했을 것이라고 말하는 것은, 믿을만해 보이지 않는다. 

우리가 갖고 있는 증거는, 다양한 생물학적 변이가 사람, 유인원. 오스트랄로피테신(현재는 멸종) 내에 오랫동안 존재했음을 나타낸다. 그리고 사람은 항상 사람이었다. 진화론자들의 최근 연구를 인용한 2018년 Creation 지의 기사처럼[21], 미토콘드리아 DNA(mtDNA) 증거는 모든 사람들이 “최초의 한 쌍(a founding pair)”에서 후손되었음과 일치한다.[22]

진화론자들도 믿지 않고 있는, 누더기가 되고 있는 진화론적 모델 대신에, 추가적 연구들로 인해 성경적 모델은 훨씬 더 신뢰할만해 보이는 것이다.


-----------------------------------------------------------------------------

타협의 어리석음


캐나다 천문학자 휴 로스(Hugh Ross, 오랜 연대를 믿는 점진론적 창조론자)의 가르침을 따르는 많은 사람들은 초자연적 창조를 믿고 진화론을 반대한다. 그리고 문자 그대로 아담과 하와의 창조를 믿는다. 그러나 그들은 장구한 지질학적 시대가 사실이라고 믿고 있기 때문에, 많은 생물들은 수십억 년에 걸쳐 점진적으로 창조되었다고 믿는다. 그들의 전체적 입장은 세속적인 46억 년의 지구 '연대'와 '빅뱅 이론'을 수용하는 것에 기초한다.

그림 2 : 모로코의 이르후드((Irhoud)) 동굴에서 발견된 현생인류(Homo sapiens) 화석(연대는 16만 년에서 31만5천 년 사이로 평가)의 두개골 캐스트. 워싱턴 DC의 스미스소니언 국립자연사 박물관에 전시되어있다. 


성경적 창조론자들은 종종 오래된 연대 창조론의 많은 문제점들을 지적해왔다. 우선, 오래된 연대 창조론은 아담의 범죄 이전에 많은 죽음과 고통이 있었다고 말한다. 그리고 '빅뱅 이론'을 믿기 때문에, 창세기 1장과는 반대로 태양이 지구 보다 먼저 생겨났다고 주장한다.

오래된 연대 창조론은 또한 아담에서 그리스도까지, 아담의 창조 이래 지금까지 대략 6천 년이 흘렀음을 가리키는 성경적 계보와도 충돌된다. 로스(Ross)는 한때 아담(최초의 진정한 인간, 호모 사피엔스)의 창조는 약 2만5천 년 전이었다고 주장했다. 따라서 수십만 년의 세속적(진화론적) 연대를 갖는, 명백히 인간처럼 보이는 네안데르탈인, 호모 에렉투스 등을 단지 영혼이 없는 원인(humanoids)이었다고 주장한다.

이 연대는 이미 크게 늘어났다. 후에 그는 말을 바꿔서 아담의 창조를 6만 년 전으로 확장했다. 이것은 아마도 5만 년 이상 전에 호주 원주민들이 이미 살았다는 세속적 '연대'에 대한 반응이었을 것이다.

그러나 이 글에서 기술된 것처럼 30만 년 전에 모로코에 현생인류인 호모 사피엔스의 두개골이 발견됐다는 사실은 로스의 입장에서는 솔직히 재앙적이다. 이것은 성경의 족보 기록과 현생인류의 출현 연대를 화해가 불가능할 정도로 멀어지게 만들었다. 이제 수십만 년 전에 성경의 초기 족장들이 살았다고 주장해야 하게 되었다. 그리고 성경에 언급되지 않은 존재들로서, 독창적인 도구와 주거지를 만들고, 음악을 연주하는 등 완전한 인간처럼 보이는 비인간이 오랫동안 지구에서 사람들과 같이 살아왔었다는 것이 된다.

그리고 치명적인 문제가 하나 더 추가됐는데, 우리 조상이 네안데르탈인과 교배하고 있었다는 DNA 증거가 발견된 것이다. 네안데르탈인은 비인간이라고 주장했기 때문에, 우리의 조상이 비인간과 수간(獸姦)을 하고 있었다고 주장해야 하게 되었다. 만약 우리의 조상이 네안데르탈인과 결혼하여 자녀를 낳을 수 있었다면, 그것은 그들이 같은 생물 종을 의미하며, 성경적으로 같은 종류(kind)인, 즉 사람이요, 아담과 하와의 후손들이지 않겠는가? (see Neandertal-Human Hybrids: old earth apologetics gone real bad).

       *관련기사 : 초기 현생 인류는 네안데르탈인들과 교잡했습니다 (2015. 6. 24. 뉴스페퍼민트)

         http://newspeppermint.com/2015/06/23/early-human-interbred-neanderthal/

이와 반대로, 성경의 기록을 세속적 연대 틀보다 더 우선하게 된다면, 이 발생하는 모든 문제들은 사라지게 된다. 발견되는 모든 증거들은 창세기와 더 쉽게 들어맞는 것이다.

------------------------------------------------------------------


References and notes

1. Line, P., The myth of ape-to-human evolution, Creation 41(1):44–46, 2019. 

2. Aiello, L.C., The fossil evidence for modern human origins in Africa: a revised view, American Anthropologist, 95(1):73, 1993. 

3. Gibbons, A., Oldest members of our species discovered in Morocco, Science, 356:993–994, 2017. 

4. New Scientist, Human Origins: 7 million years and counting. John Murray Learning, London, pp. 106–107, 2018. 

5. Gibbons, A., Reading the bones for modern human origins. Science, 257:875, 1992.

6. Thorne, A.G. and Wolpoff, M.H., The multiregional evolution of humans, Scientific American (special edn: updated from the April 1992 edn.) 13(2):46–47, 52, 2003 | doi.10.1038/scientificamerican0492-76.

7. Bae, C.J., Douka, K. and Petraglia, M.D, On the origin of modern humans: Asian perspectives, Science, 358:eaai9067. pp. 3–4, 2017 | doi:10.1126/science.aai9067. 

8. Posth, C. et al., Deeply divergent archaic mitochondrial genome provides lower time boundary for African gene flow into Neanderthals, Nature Communications, 8:16046. pp. 2, 5–6, 2017 | doi:10.1038/ncomms16046.

9. Hublin, J-J. et al., New fossils from Jebel Irhoud, Morocco and the pan-African origin of Homo sapiens, Nature 546:289–292, 2017. 

10. Richter, D. et al., The age of the hominin fossils from Jebel Irhoud, Morocco, and the origins of the Middle Stone Age, Nature 546:293–296, 2017. 

11. Barras, C., Ancient skull from China may rewrite our origins, New Scientist 236(3152):9, 18 November 2017.

12. Hershkovitz, I. et al., The earliest modern humans outside Africa, Science, 359:456, 458, 2018 | doi.10.1126/science.aap8369. 

13. Scerri, E. The origin of our species, New Scientist 238(3175):34–37, 28 April 2018. 

14. Scerri, E.M.L. et al., Did our species evolve in subdivided populations across Africa, and why does it matter? Trends in Ecology & Evolution, 33(8):582–594, August 2018 | doi:10.1016/j.tree.2018.05.005. 

15. Scerri et al., ref. 14, p. 591.

16. Wong, K., Last hominin standing, Scientific American, 319(3):60, September 2018. 

17. Henn, B.M. et al., Clarifying distinct models of modern human origins in Africa, Current Opinion in Genetics & Development, 53:148–156, 2018. 

18. Athreya, S., Picking a Bone with Evolutionary Essentialism, Anthropology News website, September 18, 2018. 

19. Lee, S-H., Where do we come from? Anthropology News website, September 18, 2018; doi:10.1111/AN.972. 

20. Galway-Witham, J. and Stringer, C., How did Homo sapiens evolve? Science, 360, 1298, 2018. 

21. Batten, D.,Recent origin of species, Creation40(4): 47. 

22. Stoeckle M.Y. and Thaler, D.S., Why should mitochondria define species? Human Evolution 33( 1–2): 1–30, 2018; doi:10.14673/HE2018121037. 


*참조 : 35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://www.kacr.or.kr/library/print.asp?no=6876

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

그리스 트라칠로스에서 발견된 570만 년 전의 완전한 사람발자국으로 붕괴되고 있는 인류 진화론

http://creation.kr/Apes/?idx=1852249&bmode=view 

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?idx=1852224&bmode=view 

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view 

원숭이도 무심코 돌 도구(석기)를 만들고 있었다 : 초기 인류가 만들었다는 타제석기는 의문스럽게 되었다.

http://creation.kr/Apes/?idx=1852220&bmode=view 

인류의 농업은 진화론적 시간 틀로 너무 늦게 시작됐다. 인류는 13,000년 전에 이르러서야 농업을 시작했다?

http://creation.kr/Apes/?idx=1852177&bmode=view

네안데르탈인은 결국 완전한 사람이었다 : 네안데르탈인의 폐활량은 현생인류보다 더 컸다.

http://creation.kr/Human/?idx=1757435&bmode=view


출처 : CMI, Creation 41(2):22–25, April 2019

주소 : https://creation.com/out-of-africa-theory-wrong

번역 : 미디어위원회

미디어위원회
2020-03-02

동물의 음악적 반응은 진화를 입증하는가?

(Musical Response in Animals Proves Evolution)

by Jerry Bergman, PhD


침팬지가 음악에 따라 몸을 흔드는 것은 진화를 입증하는가? 

그러나 새도 음악을 듣고 몸을 흔든다. 그렇다면 우리는 새로부터 진화했는가?


사람과 침팬지의 공통조상 사이의 거대한 진화적 간격을 해소하기 위해서, 여러 연구들이 시도되어 왔다. 두 명의 일본 연구자들이 수행한 새로운 연구도 또 하나의 사례이다.[1] 진화론자들의 눈에 중요하게 보이는 이 연구는 과학 분야에서 유명한 저널 중 하나인 PNAS 지에 실렸다. 저자들은 말했다 :

음악과 춤은 인간 문화 전반에 걸쳐 보편적이며, 오랜 역사를 갖고 있다. 음악의 특징 중 하나는 몸의 움직임에 강한 영향을 미친다는 것이다. 예를 들어, 청각 박동은 초기 발달 단계부터 사람에게 긍정적인 감정으로 리드미컬한 움직임을 유발한다.[2]

이 사실은 문헌으로 잘 뒷받침된다.[3] 또한 악기를 만들었던 네안데르탈인까지 거슬러 올라가며, 역사적으로 매우 오래 전부터 사실이었다.[4, 5] 이 연구에서 연구자들은 소리가 사람에서와 마찬가지로 침팬지에서도, 자발적으로 리드미컬한 움직임을 유도할 수 있다는 이론을 조사했다. 연구 결과는 침팬지가 자발적으로 음악에 맞춰 춤을 출 수 없다는 다른 연구 결과들과는 달랐다. 연구에서 음악에 반응하는 것으로 밝혀진 유일한 생물 종은 앵무새 종이었다.[6]

PNAS 지에 발표된 연구의 목표는 “약 6백만 년 전 사람과 침팬지의 공통조상에 춤에 대한 생물학적 기초가 존재했다는 진화 이론을 뒷받침하는 것이었다. 따라서 이 연구는 음악적 재능의 진화적 기원을 지지한다”고 말하고 있었다. 특별히 저자들은 인간의 음악적 재능이 침팬지와 같은 영장류로부터 기원했다고 믿고 있었다. 또한 그들은 약 6백만 년 전에, 사람과 침팬지의 공통조상에 음악과 춤이 깊이 뿌리 박혀 있었고, 존재했음을 가리키고 있다고 결론지었다.[8] 그들의 결론은 사실보다는 추측에 가까운 소설 이야기에 더 가깝다.


그들이 실제로 발견한 것은 무엇이었는가?

일본 연구자들은 "청각적 박동이 리드미컬한 흔들기 및 기타 리듬 움직임을 유발하는데, 암컷 침팬지보다 수컷 침팬지의 반응이 더 크다“는 것을 발견했는데, 사람과는 다르게 "무작위적 비트와 규칙적인 비트 모두에서, 리드미컬한 흔들기를 유발했다"는 것이다.[9] 사람은 무작위적 비트와 템포는 불편해하고, 심지어 불쾌한 반응을 일으키는 경향이 있다. 저자들은 “리드미컬한 흔들림이 규칙적 박동과 관계없이 유발되었다는 사실은 사람과 침팬지의 중요한 차이일 수 있다”고 인정했다.[10] 또 다른 차이점은, 사람의 음악적 능력은 매우 어린 나이에 지능처럼 나타나며, 음치와 같은 사람에서부터 음악적 천재(백만 명 중에 1명)와 같이 엄청나게 다양한 능력으로 나타난다는 것이다.[11] 저자들은 대부분의 동물들이 음악적 능력이 부족하다는 것을 인정하고 있었다.

몇몇 조류, 고래, 기타 종은 노래할 수 있다고 말해지지만, 유인원을 포함하여 대부분의 영장류는 노래할 수 없으며, 그들의 노래도 확실히 사람의 음악과 같은 것이 아니다. 동물에서 발견되는 음악 관련 특성들, 예를 들어 어떤 소리를 선호하는 것, 또는 비슷한 옥타브에 고정하여 듣는 경향 같은 것은, 다목적 메커니즘을 나타낼 가능성이 있다. 따라서 사람과 동물 사이의 유사성은 한 특성이 음악을 위해 진화하지 않았음을 나타낸다.[12]

또 다른 문제는 “앵무새와 바다사자를 포함하여 몇몇 동물도 청각의 리듬 박동에 대해 몸을 움직이는 능력을 갖고 있다”고 저자들은 썼다. 이것은 진화론적 패러다임과 모순된다. 왜냐하면 그러한 재능은 진화론이 예측하는 진보를 보여주지 않고, 척추동물 전체에서 흩어져서 나타나는 것처럼 보이기 때문이다.

마지막으로, 한 주요한 문제는 이 연구에서는 단지 두 마리, 즉 수컷 침팬지 한 마리와, 암컷 침팬지 한 마리만을 대상으로 실험을 했다는 것이다.[13] 사람에 있어서 음악적 재능이 엄청나게 다양하다면, 침팬지에서도 비슷한 다양성이 기대될 수 있으므로, 이 연구는 다른 영장류를 포함하여, 더 많은 침팬지들을 대상으로 시행됐어야 했다.


자연의 소리

우리는 또한 일주기리듬(circadian rhythms)뿐만 아니라, 개구리와 귀뚜라미의 울음소리, 딱따구리의 쪼는 소리, 심지어 비가 내리는 소리, 시냇물 소리, 파도 소리, 바람 소리... 같은 것들이 비슷한 리듬을 만들어낸다는 것을 알고 있다. 몇몇 동물들은 이런 종류의 리듬에 반응할 수 있다. 생물음(biophony)은 조류와 같은 생물에 의해 만들어지는 소리이고, 무생물소리(geophony)는 바람, 비, 천둥과 같은 무생물에 의해 만들어지는 소리이고, 인위적소리(anthrophony)는 사람에 의해서 만들어진 소리의 집합체이다. 그것들은 대부분의 사람들을 매우 짜증나게 만드는 소음(cacophony)을 구성하고 있는데, 환경과 인간이 만들어내는 소리가 섞여서 나는 소리이다.


이 연구 결과에 대한 논의

음악의 진화에 대한 일반적인 진화론적 주장에 의하면, 음악적 재능과 같은 능력은 생존과 직접적으로 관련되지는 않지만, 사회적 유대를 촉진하고, 따라서 간접적으로 생존을 도왔을 것이기 때문에 진화되었다는 것이다. 결과적으로 음악의 기원도 다윈의 진화론에 의해 설명될 수 있다는 것이다. 다윈은 그의 책 “인간의 유래와 성선택(The Descent of Man and Selection in Relation to Sex)”에서 80번 이상 언급했던 주제인 음악은, 찰스 다윈 자신이 확실하게 설명할 수 없었던 사람의 행동 중 하나였다.[14] 다윈은 썼다 : "음악을 즐기거나 음표를 제작하는 능력은 인간이 되는 데에 직접 사용되었던 능력이 아니다 ... 그것은 인간이 갖고 있는 가장 미스터리한 행동 중에 하나로 평가되어야 한다."[15]

다윈은 “인간의 유래와 성선택”에서 인간 이전의 (유인원) 여성에서 발생되는 고음의 목소리를 악기로 재현해보려는 시도로부터, 음악의 기원을 설명해보려고 했다. ”그들은 다른 성적 배우자를 유혹하기 위해서, 음악적 능력을 처음으로 획득했다고 추론할 수 있다“. 이러한 해석은 아직까지 음악의 진화에 대한 가장 일반적인 설명이다.[16]

사회적 결속력을 보상으로 가져오는 행동이 선택되었다는 궁색한 가정을 하고 있지만, 이것은 목표를 달성하기 위한 매우 간접적인 방법이다. 우리가 음악이라고 부르는, 어떤 소리를 잘 내는 능력을 가진 배우자가 선택되었을 것이라고 주장하지만, 진화는 대부분의 사람들이 더 중요하게 생각하는, 쉽게 만들어지는 소리를 내는 능력을 선택하지 않겠는가? 천재적인 음악적 재능은 무슨 이점 때문에 선택된 것인가?  

다시 말해, 진화론적 선택이 음악적 재능을 설명한다면, 그것은 모차르트나 바흐와 같은 수준의 음악을 만드는데 필요한 능력보다, 음악을 즐기는 수준의 일반적 능력을 선택했어야 한다. 그리고 조잡한 음악과 기계적 유형의 리듬을 습득하는 침팬지와 같은 많은 동물들도 사람의 기술을 배울 수 있다는 사실은, 사람의 과도 설계(over-design)가 아니라, 동물들의 과도 진화에 대한 증거를 보여주고 있는 것이다. 


결론

12년 전에 음악의 진화적 기원에 대한 Nature 지에 발표된 연구는 여전히 매우 정확하다. 이 연구는 음악에 대한 추측을 이렇게 결론지었다

사람의 음악적 재능은 다윈 시대 이래로 제기되어온 질문이며, 해결의 징후가 거의 없다. 경험적 접근은 대안을 제시하는 것뿐이다. 음악의 기원에 대한 완전한 설명이 나타날 것이라는 보장은 없다. 사실 현재까지 그러할 가능성은 없어 보인다.[17]

또 다른 연구자는 진화론적 설명이 다른 이유로 문제가 있다고 결론지었다 :

어떤 음악적 특성이 성선택(sexual selection)에 의해 선택되었을 것이라는 주장들이 있어왔다. 여기에서 성선택에 관해 고려해야할 중요한 부분이 있다. 특정 형질이 후손에게 전해지기 위해서는, 한 유전자에 돌연변이가 일어나야만 한다는 것이다.[18]

케임브리지 대학의 한 연구자는 음악의 진화에 대한 잡다한 이론들에 대해서 이렇게 요약하고 있었다 :

분명히, 음악이 어떻게 진화했는지에 대한 이론은 다양하다. 핑커(Pinker)는 음악은 진화론적으로 중요성이 없는 기술이며, 궁극적으로 없어도 되는 기술이라고 보았다. 로드레(Roederer), 슬로보다(Sloboda), 브라운(Brown), 하겐(Hagen), 브라이언트(Bryant)등은 음악은 그룹 수준에서 선택에 중요한 역할을 했을 수도 있다고 보았고, 밀러(Miller)는 음악은 성선택에 중요한 역할을 했을 수도 있다고 보았다. 그러나 이 모든 이론들은 휴론(Huron)이 말한 '불분명한 전례 음악(nebulous rubric music)'이라고 묘사한 것에 의존한다. 그들은 '음악'이라는 용어가 의도하는 것을 명확하게 구분하지 않는다.

따라서 다윈 안경을 쓰고 이 세계를 바라볼 때 생겨나는 추정과 추측과 공상과 가정들이 오늘날의 과학계를 지배하고 있는 것이다. 이러한 추측과 추론들은 많은 잘못된 결론을 초래한다. 가장 간단한 설명은 오직 사람만이 음악으로 간주되는 활동을 할 수 있다는 것이다. 이것은 사람이 천사보다 조금 못한 상태로 창조되었다는 성경의 가르침을 확인해주는 또 하나의 사례인 것이다. 


*참조 : 앵무새의 박자를 맞추는 능력은 어떻게 진화되었는가?

http://creation.kr/Mutation/?idx=1289790&bmode=view

노래의 박자에 맞추어 춤을 추는 새

http://creation.kr/animals/?idx=2098113&bmode=view

원숭이는 음악보다 정적을 더 좋아한다. 

http://creation.or.kr/library/print.asp?no=3989

원숭이에게 음악은 소음일 뿐이다.

http://creation.kr/Apes#2500345

인간만이 음악을 즐길 수 있도록 독특하게 설계되어 있었다. 

http://creation.kr/Human/?idx=1291518&bmode=view

자료실/진화론/유인원

http://creation.kr/Apes


References

[1] Yuko Hattori and Masaki Tomonaga. 2019. Rhythmic swaying induced by sound in chimpanzees (Pan troglodytes). PNAS. www.pnas.org/cgi/doi/10.1073/pnas.1910318116.

[2] Hattori and Tomonaga, 2019, p. 1.

[3] Mehr, S A., et al. 2019. Universality and diversity in human song. Science, 366, eaax0868, November 22.

[4] Mithen, Steven. 2007. The Singing Neanderthals: The Origins of Music, Language, Mind, and Body. Cambridge, MA: Harvard University Press.

[5] Morley, I. 2013. The Prehistory of Music: Human Evolution, Archaeology, and the Origins of Musicality. New York, NY: Oxford University Press, pp. 9, 34, 327.

[6]  Fitch, W. Tecumseh. Biology of Music: Another One Bites the Dust, Current Biology. 19(10): R404.

[7] Hattori and Tomonaga, 2019, p. 1.

[8] Hattori and Tomonaga, 2019, p. 1.

[9] Hattori and Tomonaga, 2019, p. 1; italics added.

[10]  Hattori and Tomonaga, 2019, p. 1; italics added.

[11] Shuter-Dyson, Rosamund. 1968. The Psychology of Musical Ability. London. UK: Methuen, p. 94.

[12] McDermott, Josh. 2008. The Evolution of Music. Nature, 453:287–288, May 15, p. 288.

[13] Hattori and Tomonaga, 2019, p. 1.

[14] Fisher, Helen E. 1982. The Sex Contract: The Evolution of Human Behavior.  New York, NY: William Morrow and Company, Inc., p. 97.

[15] Darwin, Charles. 1871. The Descent of Man and Selection in Relation to Sex, Vol. II, London, UK: John Murray, p. 333.

[16] Darwin, 1871, p 337.

[17] McDermott, 2008, p. 288.

[18] Cross, Ian and Iain Morley. 2009. The evolution of music: Theories, definitions and the nature of the evidence. New York, NY: Oxford University Press; Chapter 5 in Malloch, Stephen and Colwyn Trevarthen. (eds.). 2010. Communicative Musicality: Exploring the basis of human companionship, New York, NY: Oxford University Press, p. 65.

[19] Ian and Morley, 2009, p. 65.

*Dr. Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology for over 40 years at several colleges and universities including Bowling Green State University, Medical College of Ohio where he was a research associate in experimental pathology, and The University of Toledo. He is a graduate of the Medical College of Ohio, Wayne State University in Detroit, the University of Toledo, and Bowling Green State University. He has over 1,300 publications in 12 languages and 40 books and monographs. His books and textbooks that include chapters that he authored are in over 1,500 college libraries in 27 countries. So far over 80,000 copies of the 40 books and monographs that he has authored or co-authored are in print. For more articles by Dr Bergman, see his Author Profile.


출처 : CEH, 2020. 2. 14. 

주소 : https://crev.info/2020/02/musical-response-in-animals-proves-evolution/

번역 : 미디어위원회

미디어위원회
2020-01-19

사람 화석과 음식에 대한 의심스러운 오래된 연대

: 11만 년 전에도 호모 에렉투스가 살았다?

(Dates of Human Fossils and Foods Challenge Credibility)

David F. Coppedge


      화석들의 연대는 “과학”이라는 말로 포장되지 않았다면, 아무도 그 이야기를 믿지 않을 것이다.

사람들이 진화론 교육을 받지 않고, 열린 마음으로 이 화석들을 본다면, 과학자들이 화석에 대해서 말하는 것을 결코 믿지 않을 것이다. 과학자들 스스로도 그들의 해석이 믿기 어려운 것임을 인정하고 있다. 그러나 그들은 진화론적 세계관을 이미 선택했기 때문에, 그러한 연대를 반드시 믿어야한다. 모든 데이터들이 터무니없는 경우에도, 자신의 세계관에 적합하도록 해석해야 하는 것이다.

생각을 생각해보라. 모든 진화론적 교리와 장구한 시간 개념을 당신의 생각에서 제거해보라. 그리고 화석들을 살펴보고, 진화론자들이 화석에 대해 말하는 것을 주목해보라.


화석 음식

남아프리카의 한 동굴에서 불에 구워진 채소가 발견되었다. 불에 구워졌을 때는 언제일까? 이 발견은 그것을 먹은 사람들에 대해 무엇을 말해주고 있을까? New Scientist(2020. 1. 2) 지는 말한다 :

현미경 하에서 수년 동안 수백 종의 탄화된 식물의 잔해를 연구함으로써, 연구팀은 마침내 목탄 조각을 하이포시스 속(genus Hypoxis) 식물의 뿌리줄기(rhizomes, 근경)로 확인할 수 있었다.

하이포시스(Hypoxis) 식물의 뿌리줄기는 감자처럼 탄수화물이 풍부하고, 참마(yam)보다 맛이 더 좋을 수 있다고, 와들리(Wadley)는 말했다. 그 식물은 과다채집으로 오늘날 드물지만, 여전히 식용으로 사용되고 있다.

역사가 기록되기 이전부터, 사람들은 감자를 먹었다. 고대에도 다이어트를 했을 것이라고 저자는 입담을 떨고 있었다. 그러나 이제 “전문가” 과학자들은 이 유물이 17만 년 전의 것이라고 말한다. 그뿐만 아니라, 그들은 이스라엘에서 훨씬 오래된 식물 잔해들의 발견을 언급하고 있었다. “근채류(root vegetables)와 다른 식물의 씨앗들이 초기 인류가 살았던 이스라엘의 80만 년 된 곳에서도 발견되었다.” 저자들은 말했다. “그러나 와들리의 발견은 구워진 식물에 대한 가장 초기의 확실한 증거이다.” 그러한 장구한 연대는 믿을만한 것일까?

과학자들은 멋쩍어하며 이 발견은 초기 인류가 주로 고기를 먹었다는 신화를 뒤집는 것임을 인정하고 있었다. 와들리는 유감스러워 하며 말했다. “고대의 식사는 정말로 잘못된 것 같다.” 과거 사람들은 일반적으로 알려진 것보다 균형 잡힌 식사를 했던 것으로 보인다. 또한 과학자들은 17만 년의 연대가 터무니없는 것 같음을 인정했다. Phys.org(2020. 1. 2) 지는 말한다 :

와들리와 함께 고고학 연구를 수행했던, 비트바테르스란트(Widwatersrand) 대학의 과학자인 크리스틴 시버스(Christine Sievers) 박사는 말한다. “이러한 부서지기 쉬운 식물 잔해가 오랫동안 남아있었다는 것은 놀라운 일이다.”

Science(2020. 1. 3) 지의 논문은, 그 잔해는 전자스핀공명(electron spin resonance)에 의해 연대가 측정됐다고 주장하지만, 한 세기 전에는 전자스핀은 알려져 있지 않았다. 사람은 한 세기 이상 살 수 없기 때문에, 어떠한 과학자도 그 방법을 보정할 수 없었으며, 또한 현재의 과정을 3자릿수의 정밀도로 외삽하는 방법은 문제가 있을 수 있다. 선임 연구자인 와들리는 남아프리카 공화국 비트바테르스란트 대학의 위츠 진화연구소(Wits Evolutionary Studies Institute)에서 근무하고 있다. 그가 진화의 증거를 찾아내지 못한다면, 월급을 받는 것이 부담스러울까?

와들리와 같은 과학자들은 사람이 원숭이 같은 조상으로부터 얼마나 오래 전에 진화했는지에 대한 예측을 데이터로 접근한다. 그들은 그 예측에 적합한 연대를 선택한다. 이것은 그들에게 상식을 던져버리게 만들고, 부서지기 쉬운 식물이 어떻게 그렇게 오랫동안 남아있게 되었는지에 대한 “특별한” 이야기를 지어내도록 강요한다.

현미경으로 그 잔해들을 살펴보라. 그것들 중 어떤 것도 "구워진 날짜"가 기록되어 있지 않다. 사전 교육(진화론적 지식)이 없었다면, 이것이 17만 년 전의 것이라는 주장을 신뢰할 수 있을까?


우리를 신뢰하라?

“우리가 틀렸지만, 믿어도 된다”라고 말하는 전문가 그룹이 있다면, 그들을 얼마나 신뢰할 수 있을까? 초기 인류의 이야기는 번복과 수정으로 가득 차 있다. 여기 또 하나가 추가되고 있다. BBC News(2019. 12. 18)의 폴 린콘(Paul Rincon)은 “호모 에렉투스(Homo erectus): 고대 인류는 생각했던 것보다 오랫동안 살았다”라고 말했다. 누가 그렇게 생각했다는 것인가? 진화론자들이 아닌가? 우리는 그렇게 생각했던 사람들의 실수를 매번 용납해야 하는가?

그들의 오류는 무엇인가? “인도네시아에서 호모 에렉투스 화석을 찾고 있는 발굴자들은 “11만7천 ~ 10만8천 년의 연대를 가진 뼈들을 발굴했다”고 린콘은 말했다. 위에 언급된 이유로 그러한 연대는 비판될 수 있다. 그러나 진화론자들이 직면하게 된 실제 문제는 이것이다 : “이것은 전 세계에서 가장 최근까지 살았던 호모 에렉투스의 기록이다.” 

이 발견은 수십 년에 걸친 이 연구 분야의 사고가 완전히 수정되어야함을 보여준다. 우리는 유인원에서 사람에 이르는 인간의 진화가 직선적인 발전이라고 들어왔다. 이것은 구부정한 침팬지 같은 생물이 진화의 정점인 호모 사피엔스로 점진적으로 변하는 이른바 인류진화도(March of Progress) 그림으로 표현된다.

그러나 오늘날 이 그림은 훨씬 엉망이라는 것을 알고 있다. 최근의 연구는 인류행진에서 과도기 단계로 생각했던 많은 종들이 서로 수십만 년 동안 겹쳐서 동시에 존재했다는 놀라운 사실이 밝혀졌다.

.다윈의 진화론적 견해는 유인원에서 “인간”으로 진화적 “발전”을 추정했다. 그러나 이러한 그림은 사실이 아닌 것으로 확인되었다.


다시 한 번, "우리"는 누구인가? 한 세기 반 동안 이러한 오류를 가르쳐왔던 것은 진화론자들이 아닌가? 이제 그들을 누가 신뢰할 수 있을까? 

왜 이것이 진화론자들에게 특히 문제가 되는 것일까? 진화론에 의하면 호모 에렉투스(Homo erectus)는 현대인이 진화로 출현하기 수십만 년 전에 죽었어야했다. 대신에 그들은 네안데르탈인과 현대인과 나란히 살고 있었다. 더 최근의 발견에 의하면, 호모 에렉투스는 이 모든 그룹들과 교배 또는 혼합되고 있었다는 증거를 보여준다. 진화는 없었다. 암시적으로 호모 에렉투스는 동일한 인간 종이었다. 인간 진화론의 “전문가”인 크리스 스팅거(Chris Stringer)는 당혹해하고 있었다 :

"이 연대는 원시적 모습의 호모 에렉투스 화석으로서는 매우 젊은 연대로서, 이 종이 1백만 년 이상 동안 자바에서 살아왔었다는 것을 확인시켜준다."

진화론자들은 백인(유럽인)이 아닌 다른 인류 종의 이름을 "호모 에렉투스(Homo erectus)"로 명명함으로써, 인종차별주의자들처럼 행동하고 있다. 진화론자들은 항해를 했으며, 여행을 했고, 도구를 만들고, 식사를 요리할 수 있었던 고대인들을 모욕하고 있는 것이다. 진화론자들의 주장을 호모 에렉투스 족장이 들었다면 이렇게 말했을 것이다. “우리가 원시인이라고? 당신은 멍청이인가? 우리는 매머드를 사냥하고, 스테이크와 감자를 요리해서 먹고 있는데?”

게다가 진화론자들은 이러한 행동들을 했던 고대인들이 수십만 년 동안 농사를 짓거나, 말을 타거나, 동굴에서 나와 집을 짓지 못했다고 말한다. 이러한 주장은 신뢰할만한 것일까? 그것은 사람의 독창성에 대해 우리가 아는 모든 사실에 도전하는 주장이다. 그 시간의 1/10도 안 되는 기간 동안에, 사람은 오두막에서 살다가, 우주선을 만들어 태양계를 탐사하고 있지 않은가?

---------------------------------------------------


성경은 모든 인류가 단지 수천 년 전에 창조된 한 사람으로부터 유래했다고 알려준다. 대홍수 이후, 인종차별주의적 인간의 성향으로 인해, '현대인' 형제들이 도시를 짓고 있는 동안, 비교적 열등했던 특정 그룹의 완전한 사람들은 소외된 상태였다는 것을 쉽게 알 수 있다. 이것은 오늘날 열대 밀림의 소수 인종에서도 보여진다. 그들은 사람이 아닌가? 성경의 인류 이야기는 진화론의 이야기처럼 매년 개정이 필요하지 않다. 사람들은 왜 진화론 이야기에 계속 빠져드는 것일까?


*참조 : 인류의 조상들은 배를 타고 항해를 할 수 있었다 : 지중해 크레타 섬에서 석기시대(13만 년 전)의 돌연장들이 발견되었다.

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6ODt9&page=9#1852101

그리스 트라칠로스에서 발견된 570만 년 전의 완전한 사람발자국으로 붕괴되고 있는 인류 진화론

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6OTt9&page=1#1852251

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6OTt9&page=1#1852263

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6Mjt9&page=3#1852218

드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6Mjt9&page=3#1852224

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6Mzt9&page=4#1852196

원숭이도 무심코 돌 도구(석기)를 만들고 있었다 : 초기 인류가 만들었다는 타제석기는 의문스럽게 되었다.

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6MTt9&page=2#1852220

인류의 농업은 진화론적 시간 틀로 너무 늦게 시작됐다. 인류는 13,000년 전에 이르러서야 농업을 시작했다?

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6NTt9&page=6#1852177


출처 : CEH, 2020. 1. 2.

주소 : https://crev.info/2020/01/fossil-dates-challenge-credibility/

번역 : 미디어위원회



미디어위원회
2019-11-18

사람의 타액은 원숭이의 것과 근본적으로 달랐다.

(Ape Spit Radically Different from Human)

by Jeffrey P. Tomkins, PH.D.


      진화론자들은 사람과 유인원(apes, 꼬리없는원숭이류) 사이의 진화론적 유사성을 찾으려고 노력하면서, DNA, 단백질, 해부학, 행동 및 기타 가능한 모든 특징들을 비교해왔다. 그러나 이러한 시도들 중 다수는 진화적 연관성이 없는, 구별되는 거대한 비유사적 간격이 존재한다는 것을 보여주었다. 그리고 이제 사람과 유인원의 타액(saliva)을 비교하는 새로운 연구가 다시 한 번 사람의 독특함과 진화론적 추론의 실패를 보여준다.[1]

타액은 소화관으로 들어가기 전에, 입에서 음식을 전처리하는 데 필요한, 고도로 설계된 주요한 단백질들이 정확하게 조합되어 있는 액체이다. 또한 사람의 타액에는 치아 미네랄의 유지와 병원성 미생물로부터 보호되는 데에 필요한 특정 유형의 다른 단백질들이 포함되어 있다. 타액 내에 있는 단백질들의 총합을 타액 프로테옴(salivary proteome)이라 불려지고 있다.

최근 연구에서 과학자들은 사람의 타액 프로테옴과 사람의 가장 가까운 살아있는 진화론적 친척이라고 말해지는 침팬지(chimpanzees)와 고릴라(gorillas)의 타액 프로테옴을 비교했다. 또한 그들은 먼 진화적 친척으로 말해지는 히말라야원숭이(Rhesus macaque)를 포함시켜 비교하였다.

연구자들이 관측했던 첫 번째 주요한 차이점은, 사람의 타액은 유인원의 타액보다 수분이 많고, 희석되어 있으며, 단백질의 전체 농도가 훨씬 낮다는 것이다. 실제로, 사람의 타액은 침팬지, 고릴라, 그리고 히말라야원숭이의 타액에 비해 총 단백질 양이 절반밖에 되지 않는다.(아래 그림 참조). 다음으로 과학자들이 관측한 것은 주요 단백질 그룹의 농도가 사람과 유인원의 타액 사이에서 현저히 달랐다는 것이다. 또한 연구자들은 유인원에 존재하지 않는 사람-특이적 단백질들이 발견되었다고 지적했다. 전체적으로 타액 프로테옴은 사람과 유인원 사이에서 뿐만 아니라, 침팬지, 고릴라, 히밀라야원숭이들 사이에서도 서로 분명히 달랐다.

연구자들은 그들의 결론에서 말했다 : “우리는 사람의 타액에서 비인간 영장류의 타액과 구별되는 고유한 단백질 형태들을 발견했다”. 또한 “사람 및 비인간 영장류 타액의 특별한 특성과 성분들은 계통적으로 특성화된 방법(lineage-specific manner)으로 진화했을 수 있다”라고 그들은 주장했다. 계통적이라는 용어는 진화적 중복이 없었음을 의미한다. 사람, 유인원, 원숭이의 타액 프로테옴은 각각 독특했다. 이 관찰은 진화론과 일치하지 않지만, 생물들은 하나님에 의해서 각기 그 종류대로(after its kind) 창조되었다는 창세기와 잘 어울린다. 사람, 침팬지, 고릴라, 히말라야원숭이들은 각각 독특한 종류이며, 과학과 성경은 이러한 생물학적 진실을 계속해서 확인시켜주고 있는 것이다.


References

1. Thamadilok, S. et al. 2019. Human and Non-Human Primate Lineage-Specific Footprints in the Salivary Proteome. Molecular Biology and Evolution. msz223.

*Dr. Tomkins is Life Sciences Director at the Institute for Creation Research and earned his doctorate in genetics from Clemson University.


*참조 : 자료실/진화론/유인원

http://creation.kr/Apes


출처 : ICR, 2019. 11. 12.

주소 : https://www.icr.org/article/ape-spit-radically-different-from-human/

번역 : 미디어위원회

미디어위원회
2019-11-01

고대 인류의 유물이 섬에서 발견되었다 : 초기 인류는 배를 타고 항해를 했다.

(Early Humans Sailed to Islands)

David F. Coppedge

    섬에서 발견된 돌연장(stone tools)과 뼈들은 네안데르탈인과 다른 고대인들이 그곳에 배를 타고 왔음을 보여준다.

진화 고인류학자들은 한 세기 동안 네안데르탈인이 동굴에 살던 짐승 같은 멍청한 원시인이라고 묘사해왔다. 그러나 그들은 우리처럼 현명하고 능력이 있었다는 사실이 지속적으로 발견되고 있다.(2019. 4. 29)


그리스의 한 섬에서 초기 인류의 유물이 발견됐다.(Science Advances2019. 10. 16). 예수님이 아니라면, 물 위를 걸어서 섬으로 갈 수 없다. 진화론적 연대로 20만 년 전의 유물이 어떻게 그리스 에게해(Aegean Sea)의 한 섬에 있게 된 것일까? 그것을 만든 사람들은 배를 타고 왔다고 연구자들은 잠정적으로 제안하고 있었다. 지질학자들이 육지다리나, 물이 얕아서 섬을 걸어서 들어갔다는 것을 입증할 수 없다면, 사실 배를 타고 도착했다는 것은 유일한 합리적 설명이다. 이것은 네안데르탈인과 다른 호미닌들이 현대인보다 원시적이라고 생각했던 견해를 완전히 뒤집어엎는 발견이다.

여기에서 우리는 오늘날 에게해 분지 한가운데의 낙소스(Naxos) 섬에 있는, 스텔리다(Stelida)의 규질암에서 발굴된 증거들을 자세히 보고한다. 고고학적 연대로 20만 년 전에 빙하기 동안에 땅이 노출되어 아나톨리아가 유럽 남동부와 연결되어 있었거나, 항해에 의해서, 또는 두 가지의 조합을 통해서, 호미닌(hominins)이 이 지역에 들어와 있었음을 가리킨다.(그림 1). 홍적세(Pleistocene)의 남은 기간 동안에 이 지역은 (3~4만 년 전의 초기 호모 사피엔스들을 포함하여) 고대인들이 거주했거나, 산발적으로 방문했음(배를 타고 도착)을 가리킨다. 나중에는 항해하던 초기 충적세(Early Holocene)의 중석기 사냥꾼-수집가들에 의해서 방문되었음이 분명하다.

.낙소스는 에게해의 한가운데에 있는 섬이다. 가장 가까운 육지는 120~144km 떨어져 있다. (Google Earth)


과학자들은 초기 인류가 생각보다 일찍 지중해를 건너갔음을 발견했다.(Science Daily2019. 10. 16)평소와 같이 고인류학자들은 그들이 발견한 것으로 인해 충격을 받고 있었다. 멍청한 짐승 같은 유인원이 어떻게 바다를 건너갔는가? 낙소스는 섬이다!

맥마스터 대학(McMaster University)의 과학자들이 이끄는 국제 연구팀은 그리스에 있는 낙소스 섬에서 네안데르탈인과 그 이전 인류가 이전에 생각했던 것보다 수만 년 이전인, 적어도 20만 년 전에 거주했음을 입증하는 새로운 증거를 발굴했다.

그들은 네안데르탈인 보다 “초기 인류”에 대해 이야기하고 있음을 주목하라. 초기 인류는 호모 에렉투스(Homo erectus) 또는 다른 호모의 구성원일 것이다. 창조론자들은 이들도 사람이었다고 주장해왔다. 그들이 배를 타고 섬으로 들어갔다면, 과도기적 형태의 유인원이 아니었음이 분명하다.

이 논문에서 발굴 팀은 낙소스 섬 북서쪽 해안의 선사시대 채석장인 스텔리다(Stelida)에서, 약 20만 년에 걸친 인간 활동의 증거들을 자세히 설명하고 있다. 여기에서 초기 호모 사피엔스, 네안데르탈인, 초기 인류는 지역 석재(규질암, chert)를 사용하여, 그들의 도구와 사냥 무기들을 오랜 기간 동안 만들어왔다.

현장에서 수집된 많은 과학적 데이터들은 인류의 이동 시에 해안 및 해양 경로의 중요성에 대한 논란을 추가하고 있었다. 현재 데이터에 따르면, 20만 년 전에 에게해를 건너갈 수 있었으며, 저자들은 네안데르탈인도 근거리를 건너갈 수 있는 조잡한 형태의 항해용 선박을 만들었을 가능성을 제시하고 있다.

만약 초기 인류가 그 섬에 있었다면, 그들은 배를 사용했음에 틀림없다. 그들은 왜 그 배를 조잡한(crude) 항해용 선박이라고 했을까? 그것이 조잡했는지는 알 수 없다. 나무로 만들어졌을 배는 수십 년이나 수백 년 후에는 흔적이 남지 않을 것이다. 그래서 연구자들은 그 배를 조잡했을 것이라고 상상하고 있는 것이다.

수년간의 발굴에 기초하여, Science Advances 지에 발표된 이 발견은 이 지역의 인류 이동에 대한 현재의 생각에, 즉 현대인 외에는 이러한 섬에 접근할 수 없었고, 거주할 수도 없었을 것이라는 오랫동안 갖고 있던 생각에 도전하는 것이다. 이 새로운 증거는 초기 조상들이 아프리카에서 유럽으로 이주했다는 이동 경로를 재고하도록 만들고 있었으며, 새로운 환경의 도전에 적응할 수 있는 능력을 갖고 있었음을 보여주고 있다.

진화 고인류학자들은 고대인들이 이 섬에서 돌연장의 재료(규질암)를 얻기 위해서 반복적으로 배를 타고 왔었다고 제안했다. 이것은 그들이 자주 항해를 했다는 것을 가리킨다. 이 시기는 그들의 연대 틀로 15만 년이나 지속됐다는 것이다. 만약 그들이 배를 만들어서 바다를 건너갈 수 있도록 현명했다면, 그 기간 동안 왜 그들은 도시를 만들지 못했고, 농업을 시작하지 못했으며, 가축을 기르지 못했는가? 당신은 진화론자들의 이야기가 합리적이라고 생각되는가?

-------------------------------------------------------------

진화론자들은 자신들이 틀렸다는 것을 인정할 수 없다. 그래서 우리가 폭로해주는 것이다. 그들은 “이러한 발견은 현재의 사고에 도전하는 것이다”라고, 또는 “오래 생각해왔던 것과 배치된다”라고 말하며, 그들의 수치심을 숨기도 있다. 그러한 생각은 누가 했던 것인가? 누가 그렇게 오래 생각해왔다는 것인가? 진화론자들이 그렇게 생각해왔던 것 아닌가? 그들이 만들어낸 신화에 넘어가지 마라. 인류 진화에 대한 그들의 이야기는 붕괴되고 있고, 그것과 함께 수십 수만 년이라는 장구한 시간 틀도 붕괴되고 있는 중이다.


배를 타고 왔던 사람들은 유인원이 아니라, 진정한 사람이었다. 그들은 그렇게 오래 전에 살지 않았다. 그들은 수십만 년 전에 살았던 사람들이 아니라, 단지 수천 년 전에 살았던 사람들이다. 이것은 성경에 묘사된 바벨탑의 분산과 적합하다. 노아 홍수 후에 탐험가들은 지적인 인간의 두뇌를 사용하여, 도구를 만들 재료들을 찾기 위해 장거리를 이동했고, 적절한 곳에서 정착했다. 그들은 영구 거주지, 마을, 도시를 만드는 데에 시간이 걸렸지만, 오랜 시간이 걸리지는 않았다. 이것은 이치에 맞는다. 기록된 인류 역사의 20배의 기간 동안 배를 만들었던 현명한 인간이 동굴에서 원시적으로 살아왔다는 진화론의 이야기는 매우 우스꽝스러운 이야기인 것이다.



*참조 : 인류의 조상들은 배를 타고 항해를 할 수 있었다 : 지중해 크레타 섬에서 석기시대(13만 년 전)의 돌연장들이 발견되었다.

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6ODt9&page=9#1852101

그리스 트라칠로스에서 발견된 570만 년 전의 완전한 사람발자국으로 붕괴되고 있는 인류 진화론

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6OTt9&page=1#1852251

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6OTt9&page=1#1852263

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6Mjt9&page=3#1852218

드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6Mjt9&page=3#1852224

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6Mzt9&page=4#1852196

원숭이도 무심코 돌 도구(석기)를 만들고 있었다 : 초기 인류가 만들었다는 타제석기는 의문스럽게 되었다.

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6MTt9&page=2#1852220

인류의 농업은 진화론적 시간 틀로 너무 늦게 시작됐다. 인류는 13,000년 전에 이르러서야 농업을 시작했다?

http://creation.kr/Apes/?q=YToyOntzOjEyOiJrZXl3b3JkX3R5cGUiO3M6MzoiYWxsIjtzOjQ6InBhZ2UiO2k6NTt9&page=6#1852177



출처 : CEH, 2019. 10. 28.

주소 : https://crev.info/2019/10/early-human-sailors/

번역 : 미디어위원회

미디어위원회
2019-10-07

원숭이에게 음악은 소음일 뿐이다.

(Music Is Noise to Monkeys)

David F. Coppedge


     실험에 의하면 원숭이(monkeys)의 뇌는 사람의 뇌와 다르게, 음악보다 소음을 더 선호하고 있었다.

국립보건원(National Institutes of Health)의 한 신경과학자는 원숭이도 사람처럼 음악에 관심이 있는지 궁금해 했다. 원숭이의 눈은 사람의 눈처럼 보고 있을까? 그리고 그들의 귀는 우리처럼 듣고 있는 것일까? The Scientist(2019. 10. 1) 지에서 카타리나 짐머(Katarina Zimmer)는 베빌 콘웨이(Bevil Conway)가 그 질문의 답을 얻기 위해 시도한 실험 이야기를 들려주고 있었다. 간단히 말해서, 기사 제목이 말하고 있는 것처럼, "사람이 음악을 들을 때, 원숭이는 소음으로 듣고 있을 수 있다"는 것이다.

콘웨이와 동료들은 기능자기공명영상(functional MRI, fMRI) 장비를 사용하여, 사람과 짧은꼬리원숭이(macaques)가 음악과 소음을 들었을 때, 뇌의 영역이 각각 어떻게 변하는지를 관찰했다.

과학자들은 3마리의 원숭이와 4명의 사람에 대해, fMRI 영상 촬영 장비 안쪽에서 음악을 들려주면서, 실험자의 청각 피질이 어떻게 변하는지를 모니터링 하였다. 이전 실험에서 관찰됐던 것처럼, 사람의 청각 피질은 소음(noise) 보다 조화로운 선율에 대해서 상당히 큰 활성적 반응을 나타냈다. 그러나 콘웨이에게 놀랍게도, 짧은꼬리원숭이의 동일한 뇌 영역은 두 종류의 소리에 대해 큰 차이의 반응을 보이지 않았다. 사실, 원숭이의 뇌는 종종 조화로운 선율보다 소음에 더 큰 반응을 보였다.

소리에 대한 원숭이의 반응에 대한 정확한 실험적 평가에 의하면, 원숭이의 귀는 음악을 들을 수 없는 것처럼 보인다. 원숭이에게 음악은 소음일 뿐이었다. 원숭이들은 서로 소리를 지르기 때문에, 이것은 콘웨이에게 이상하게 보였다. 이것에 대해 짐머는 사람은 언어를 사용하여 의사소통을 하기 때문에, 음악을 감상할 수 있지만, 원숭이가 그렇지 않다는 것이다. 언어는 조화로운 소리를 가진 모음들이 풍부하다. 그러나 언어에는 조화로운 음성보다 많은 것들이, 즉 의미론, 구문론, 미학이 들어있다. 원숭이의 뇌는 언어를 이해할 수 없다. 소리는 특정 행동을 유발하는 의미 없는 표시일 뿐이다.

----------------------------------------------


진화론자들은 왜 사람만이 언어를 이해하고, 음악을 이해하는지를 이해하지 못하고 있다. 그들에게 사람의 뇌는 완전한 미스터리이다. 진화론자들은 사람의 뇌는 유인원의 뇌에서 진화했다고 믿고 있지만, 과학, 음악, 미술, 문학, 스포츠 등을 포함하여, 사람의 뇌가 수행하는 독특한 특성에 감탄하고 있다. 진화론자들은 아는 것보다 모르는 것이 훨씬 더 많다. 그러나 진화론자들이 절대적으로 확실하다고 생각하고 있는, 절대적으로 잘못된 한 가지가 있다. 무신론자가 아니라면, 그들의 대화에 참여할 수 없다는 것이다! 죽은 자들로 자기의 죽은 자들을 장사하게 하라. (눅 9:60)



*참조 : 원숭이는 음악보다 정적을 더 좋아한다.

http://www.creation.or.kr/library/itemview.asp?no=3989

원숭이는 음악을 들을 수 있는 귀를 가지고 있지 않다

http://www.creation.or.kr/library/itemview.asp?no=2447



출처 : CEH, 2019. 10. 1.

주소 : https://crev.info/2019/10/music-is-noise-to-monkeys/

번역 : 미디어위원회

미디어위원회
2019-10-04

한 화석의 발견으로 또 다시 번복되고 있는 인류 진화 이야기

: 오스트랄로피테쿠스 아나멘시스와 아파렌시스는 공존했다.

(Fossil Ape Skull Is a Game Ender) 

by Brian Thomas, PH.D.  


     최근 젊은 미국인들에 대한 여론 조사에 따르면, 진화론 논쟁에서 가장 설득력 있는 과학적 근거는 유인원과 같은 인류의 진화론적 조상들의 연속적인 진화계통도인 것으로 밝혀졌다.[1] 그러나 지금까지 제안된 모든 인간 조상들의 진화적 위치에 대한 연구자들 사이의 불일치는, 이 인류 진화계통도에 대한 타당성과 신뢰성을 약화시킨다. 창조론자인 마빈 루베노(Marvin Lubenow)는 그의 책 “논쟁 중인 뼈들(Bones of Contention)”에서 그것을 “거짓 퍼레이드(fake parade)”이라고 불렀다.[2] 새로운 한 유인원 화석 연구에 따르면, 이 화석 퍼레이드를 사기로 여겨야할 추가적인 이유를 제공하고 있었다.


Nature 지에 게재된 한 논문에서, 연구자들은 새로운 얼굴 형태와, 이전에 치아와 뼈 조각만 알려졌던 멸종된 유인원 종에 대한 모순되는 연대를 함께 갖고 있는, 한 화석 두개골에 대해 보고하고 있었다.[3] 연구팀은 그 화석을 2016년에 에티오피아 아파르(Afar) 지역에서 발견했다. 초기에 그들은 그 화석을 오스트랄로피테쿠스 아파렌시스로 확인했지만, 분석 후에 그것을 아나멘시스로 수정했다.


오스트랄로피테쿠스 아나멘시스(Australopithecus anamensis)는 오스트랄로피테쿠스 아파렌시스(Australopithecus afarensis)의 직계 조상으로 추정되고 있다. 오스트랄로피테쿠스 아파렌시스는 일명 루시(Lucy)라는 별칭을 갖고 있는 유명한 화석으로, 일부는 진화하여 사람까지 되었다고 주장된다. 그러나 많은 진화론자들은 이 멸종된 유인원 종과 인류 사이에 어떠한 해부학적 연관성을 찾지 못하고 있다. 한 동물학자는 “그들은 원숭이 일뿐”이라고 인정하고 있다.[4]


성경을 믿고 있는 과학자들은 두 종의 오스트랄로피테쿠스는 창조된 같은 종류의 원숭이(현재는 멸종)로 보고 있다. 이러한 관점에서, 그들은 같은 시기에 아마도 다른 장소에서 살았던 원숭이였을 것이다. 오늘날에도 멀리 떨어진 대륙에서 침팬지 변종들이 동시대를 살아가고 있다. 오늘날 흔한 침팬지(Pan troglodytes)는 매우 넓은 서식지를 갖고 있다. 그래서 매우 희귀한 피그미 침팬지인 보노보(bonobo, Pan paniscus)는 콩고 분지의 콩고 강 남쪽에만 서식하는 것으로 나타난다.


오스트랄로피테쿠스 아나멘시스가 오스트랄로피테쿠스 아파렌시스로 진화했다는 추정 이야기는 아나멘시스 화석이 아파렌시스 보다 더 아래 지층에서 발견되었을 때, 쉽게 만들어졌다. 그러나 이번에 새롭게 보고된 아나멘시스 두개골은 이들이 아파렌시스와 10만 년 동안 같은 시대를 공존했다는 것이다. Nature 지의 선임 저자인 막스 플랑크 연구소(Max Planck Institute)의 헤일 젤라시(Haile-Selassie)는 다음과 같이 말했다 : “이것은 플라이오세(Pliocene) 동안 인간의 진화에 대한 우리의 이해에 있어서 판도를 뒤바꾸는 중요한 발견이다.”[5]

 

이것은 판도를 뒤바꾸는 중요한 발견이 아니라, 인간 진화 이야기들 중 하나를 쓰레기통에 던져버리는 발견이다. 이들 멸종된 유인원들이 무려 10만년 동안이나 공존했다는 것은 이들 사이의 조상-후손 관계를 폐기시키는 발견인 것이다. 그리고 이것은 창조된 종류 내에서 다양성이 발생했다는 창세기 기록과는 일치하는 발견이다. 



References

 1. Biddle, D. A., and J. Bergman. 2017. Strategically dismantling the evolutionary idea strongholds. Journal of Creation. 31(1): 116-119.

 2. Lubenow, M. 2004. Bones of Contention. Grand Rapids, MI: Baker Books, 167.

 3. Haile-Selassie, Y. et al. 2019. A 3.8-million-year-old hominin cranium from Woranso-Mille, Ethiopia. Nature. Posted on Nature.com before print, August 28, 2019, accessed September 2, 2019.

 4. Lewin, R. 1987. Bones of Contention: Controversies in the Search for Human Origins. Chicago, IL: University of Chicago Press, 164.

 5. A face for Lucy’s ancestor. Max Planck Institute. Posted on mpg.de August 28, 2019, accessed September 2, 2019. 

*Dr. Thomas is a Research Associate at the Institute for Creation Research and earned his Ph.D. in paleobiochemistry from the University of Liverpool.    



*관련기사 : 인류: 새로 발견된 화석으로 인류의 기원에 대한 기존 학설이 흔들린다 (2019. 8. 29. BBC News 코리아)

https://www.bbc.com/korean/news-49505826

380만년 前 화석, 인류의 진화史 뒤집어 (2019. 9. 5. 조선일보)

http://biz.chosun.com/site/data/html_dir/2019/09/05/2019090500226.html


*참조 : 드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.or.kr/library/print.asp?no=5796

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://www.kacr.or.kr/library/print.asp?no=6876

농업의 기원은 진화론적 장구한 연대를 부정한다. : 30만 년 전에 출현한 현대 인류가 1만 년 전에 농업을 시작?

http://www.kacr.or.kr/library/itemview.asp?no=6856

그리스 트라칠로스에서 발견된 570만 년 전의 완전한 사람발자국으로 붕괴되고 있는 인류 진화론

http://www.creation.or.kr/library/print.asp?no=6759


출처 : ICR, 2019. 9. 17.

주소 : https://www.icr.org/article/fossil-ape-skull-game-ender/

번역 : 미디어위원회

 



서울특별시 중구 삼일대로 4길 9 라이온스 빌딩 401호

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 오경숙

사업자번호 : 120-87-70892

통신판매업신고 : 제 2018-서울중구-0764 호

주소 : 서울특별시 중구 삼일대로 4길 9, 라이온스빌딩 401호

대표전화 : 02-419-6484

개인정보책임자 : 김광