미디어위원회
2021-07-08

현대인과 매우 유사한 '동굴 여성'의 DNA

(DNA of ‘Cave Woman’ Very Similar to Ours)

by Jerry Bergman, PhD


35,000~40,000년 여성의 유전체 염기서열이 분석됐다 :

가장 오래된 알려진 인간들 중 하나는 예상보다 훨씬 더 우리를 닮았다


     유전학(Genetics)은 오늘날 가장 뜨겁고 빛나는 과학 분야 중 하나이다. 그것은 암 치료에 혁명을 일으키고 있으며, 변형된 유기체의 탄생을 허용하고 있다. 그것은 또한 유전자 변형 기술을 통한 기능-획득(gain-of-function)에 혁명을 가져왔다. 지금까지 알려진 바에 의하면, 기능-획득 기술은 현대 역사상 최악의 유행병의 원인인 것으로 보인다. 한 연구는 미국에서만 90만 명 이상이 COVID-19로 사망했다고 결론지었다.[1] 워싱턴 대학 건강측정평가연구소(Institute for Health Metrics and Evaluation)의 연구자들은 전 세계적으로 COVID-19 사망자가 거의 7백만 명에 이른다고 말했다.[2] 


유전학과 진화론

유전학이 밝혀낸 또 다른 분야는 진화론 분야이다. 사실, 그 분야는 다윈의 진화론에 의심을 갖게 하는 유전정보에 관한 것을 밝혀내었다. 웁살라 대학(Uppsala University)의 연구자들은 루마니아의 페스테라 뮤이어리(Peştera Muierii, '여성의 동굴(women’s cave)'로 번역됨) 동굴에서 발견된 화석에 대해 전체 유전체(genome)의 염기서열을 분석했다. 페스테라 뮤이어리는 루마니아 남부에 있는 동굴로서 이곳에서 3명의 여성 유골이 발견되었다. 이들 3명의 여성은 진화론적 시간 틀로 3만5천 년에서 4만 년 전에 살았던, Peştera Muierii 1, Peştera Muierii 2, Peştera Muierii 3이다. Peştera Muierii 1의 유전자 염기서열 분석 결과는 다음과 같은 것을 발견했다 :

그녀는 5,000년 더 초기의 유럽인들보다 더 현대 유럽인처럼 보인다. 그러나 그 차이는 우리가 생각했던 것보다 훨씬 적다 …그녀는 현대 유럽인들의 직접적인 조상은 아니지만, 지난 빙하기 말까지 유럽에 살았던 수렵-채집인의 선조들이다."[3]

그녀는 진화론자들이 3만5천~4만 년의 여성에게 기대했던 것처럼, 유인원과 같은 존재였을까? 그녀의 두개골 모양을 근거로, 연구자들은 그녀는 "현대인과 네안데르탈인 둘 다"와 유사하다고 결론지었다. 이런 이유로, 그들은 그녀가 다른 동시대의 사람들보다 네안데르탈인의 유전자를 더 많이 갖고 있을 것으로 추정했다."[4]

그러나 그 가정은 데이터에 의해 거부되었다. 유전자 연구는 "그 여성은 그 시대에 살았던 대부분의 다른 개체들과 같이 낮은 수준의 네안데르탈인 DNA를 갖고 있었다"고 결정했다. 즉 그녀는 높은 수준의 현대인의 DNA를 갖고 있었던 것이다. 간단히 말해서, 진화론자들은 그녀가 그들이 예상했던 것보다 훨씬 덜 원시적이며, 네안데르탈인과 비슷하지 않다는 것을 발견했다. 또한 이 연구는 현대인과 네안데르탈인이 교배했었다는 결론을 입증하는 또 하나의 증거가 되고 있었다. 이 증거는 네안데르탈인이 단지 다른 인간 집단이었다는 견해를 추가로 입증해주는 것이었다. 네안데르탈인은 한때 믿고 있었던 것처럼, 유인원과 인간을 연결시켜주는 증거가 아니었다. 진화론자들이 "동굴인(cavemen)"이라고 붙였던 경멸적인 꼬리표는 이제 잘못된 것임이 밝혀진 것이다.

.네안데르탈인은 필트다운인과 현대인의 중간으로 말해지고 있다. <From Scientific American, May 1923, p. 302.> 


또한 이 발견은 두개골(cranium) 특성을 나타내는 소수의 유전자만이 현대인과 네안데르탈인을 구별하는 증거라는 것이다. 덧붙여서 이 연구는 진화론자들이 수만 년 전으로 믿고 있는 인간 화석들의 변이 정도와 현대성(modernity)이 진화론이 예상하는 것보다 훨씬 적다는 것을 입증해주었다.

연구자들은 또한 지난 35,000년 동안 유럽의 유전적 변이를 추적할 수 있었고, 마지막 빙하기 동안 변이(variations)의 뚜렷한 감소를 볼 수 있었다. 감소된 유전적 다양성은 이전에 아프리카 밖의 개체군들 사이에서 더 흔하게 나타나는 유전체의 병적인 변형과 연결되어 있었지만, 이것은 논쟁의 여지가 있다.[5]

또한 유전체의 진화는 한 문제점을 드러내고 있는데, 왜냐하면 진화는 유익한 특성이 자연 선택되도록 하는 변화들을 증가시켜야 하기 때문이다. 이것은 변이가 일어난 최적자에 선택적 우위를 부여하고, 생존에 불리한 모든 변이들에 반대되도록 작동되어야 한다. 변화와 선택이 없다면, 진화는 일어날 수 없다. 이 연구가 발견한 바와 같이, 적은 변이는 창조론적 세계관을 지지한다. 원래의 완벽한 창조는 유전적 엔트로피에 기인하여 쇠퇴되어가며, 변이는 줄어들 것이다. 따라서 이 연구는 후기 구석기(Upper Paleolithic) 초기의 "사냥-채집인“ 유럽인들은 높은 유전적 다양성을 보여주며, 이것은 다양성의 심각한 소실이 마지막 최대 빙하기(Last Glacial Maximum, LGM)와 그 이후에 발생했음을 보여준다.[6]

또 다른 중요한 발견은 "고대 유전체와 현대 유전체 사이의 단백질 변형이 일어난 정도는 큰 차이가 없었다는 것이었다... [또한] 고대 유전체의 세 집단(LGM 전, LGM 후, 신석기)은 현대인의 진유전체(exomes)와 큰 차이를 보이지 않았다.[7] [진유전체는 인트론(introns)이 RNA 스플라이싱에 의해서 제거된 후 남겨진, 엑손으로 구성된 유전체의 부분][8]

게다가, "고대 진유전체들 중 어떤 것도 현대 진유전체와 현저한 차이를 보여주지 않았고, 이들 개체들에 일어난 변형 정도는 현대인의 것과 대체로 같았다"는 것이다.[9] 평가된 자료에 따르면, 이러한 비교는 35,000년에서 40,000년 사이에 사실상 진화가 일어나지 않았음을 나타낸다. 고려되어야 할 또 다른 견해는, 동굴에서 발견된 여성들의 두개골은 4만 년이 되지 않았을 수도 있다는 것이다. 사실, 할당된 4만 년이라는 연대는 진화론적 세계관을 손상시키고 있다.

이 생겨나는 문제는 진화론자들이 그들의 이론을 유지하기 위해서 수백만 년, 심지어 수십억 년 이상의 연대를 가정해야 하기 때문이다. 만약 10,000년 된 DNA 샘플이 현대인과 거의 동일한 것이라면, 진화의 증거를 위치시키기 위한 시간이 충분하지 않다는 것을 의미한다. 만약 20,000년으로 거슬러 올라가 다른 발견이 있다하더라도, 진화에 대한 증거가 부족하다는 같은 대답이 제시될 것이다. 그리고 4만5천 년 전으로 거슬러 올라가는 또 다른 발견이 있다면, 동일한 대답이 제시될 것이다. 다시 말해서, 인류의 진화론적 변화는 시간적으로 점점 더 뒤로 밀려날 뿐이다. 진화론자들이 말하는 것처럼 증거의 부족은 증거가 아니다.


페스테라 뮤이어리 1이 현대 인류보다 우월한 한 가지

한 가지 매우 중요한 발견은 페스테라 뮤이어리 1은 현대인에 비해 더 강인했으며, 강력한 면역시스템을 갖고 있었다는 것이다.

전반적으로, 이러한 데이터는 페스테라 뮤이어리 1이 사이토카인(cytokine) 생산 능력이 더 높았다는 것을 시사한다. 이에 비해 현대 유럽인에서 사이토카인 다형성은 4% 미만임을 보여준다. 감염 위험성이 높은 상황에서 활발한 면역반응의 보호 효과를 고려할 때, 이러한 유전자 구성은 병원성 미생물의 방어에 대한 적응을를 나타낼 가능성이 높다.[10]


분석에서 관심사 

한 주요 관심사는 DNA는 매우 연약한 분자로서, '취약 부위'라고 불리는 장소들보다 훨씬 더 취약한 장소들을 포함하고 있다는 것이다.[11] 동굴 환경은 실제로 DNA 퇴화의 주요 원인인 우주방사선으로부터 뼈를 보호하는 데 도움을 주었을지 모른다. 또한 동굴의 온도와 습도 안정성은 표본을 안정화시킴으로써 악화(deterioration)를 감소시키는데 도움이 된다.

그럼에도 불구하고, 저자들은 "일반적으로 초기 구석기 시대(Early Upper Paleolithic, EUP)의 표본에서 DNA의 보존은 열악하며, 이러한 데이터로부터 추론은 매우 제한적이다"라고 인정하고 있었다.[12] 새로운 DNA 추출 기법은 오래된 기법에 비해, 고대 유골에서 33배나 더 많은 DNA를 복구할 수 있게 해주었다. 분석은 심지어 여성들이 비교적 어두운 피부 색깔과 갈색의 눈을 가졌을 가능성과 같은, 세부 사항들을 DNA로부터 결론내릴 수 있게 해준다.[13]


요약

이 연구의 결과는 35,000에서 40,000년 전으로 주장되는 여성에서 어떠한 진화의 증거도 보여주지 않았다. 그 긴 기간 동안, 진화론자들은 비록 영향은 미미할지라도, 중요한 진화적 변화를 예상했다. 발생했던 변화는 창조론자들이 예측하고 있는 유전체의 쇠퇴에 불과한 것이다. 예를 들어, 면역시스템은 현대인보다 페스테라 뮤이어리 1에서 훨씬 더 강력했다.

지금까지 3만 년 이상 된 완전한 유전체의 염기서열 분석은 거의 이루어지지 않았지만, 더 많은 염기서열 분석이 이루어진다면, 진화론적 세계관이 사실이 아니라, 창조론적 세계관이 진실임이 밝혀질 것이다.


References

[1][1] Sullivan, Becky, New study estimates more than 900,000 people have died of COVID-19 in U.S., NPR 50, 6 May 2021. Emphases added.

[2] Sullivan, 2021.

[3] The entire genome from Peştera Muierii 1 sequenced  Uppsala University, 2021..

[4] The entire genome from Peştera Muierii 1 sequenced. 2021.

[5] The entire genome from Peştera Muierii 1 sequenced. 2021.

[6] Svensson, Emma, et al., Genome of Peştera Muierii skull shows high diversity and low mutational load in pre-glacial Europe, Current Biology, 18 May 2021. DOI: 10.1016/j.cub.2021.04.045, . Italics added.

[7] LGM is the Last Glacial Maximum era.

[8] Svensson, Emma, et al. 2021.

[9] Svensson, et al., 2021.

[10] Svensson, et al., 2021.

[11] Mitchell, Alison, The fragility of DNA, Nature Reviews Molecular Cell Biology 4:88, 1 February 2003.

[12] Svensson, et al., 2021.

[13] Svensson,. et al., 2021.

*Dr. Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology for over 40 years at several colleges and universities including Bowling Green State University, Medical College of Ohio where he was a research associate in experimental pathology, and The University of Toledo. He is a graduate of the Medical College of Ohio, Wayne State University in Detroit, the University of Toledo, and Bowling Green State University. He has over 1,300 publications in 12 languages and 40 books and monographs. His books and textbooks that include chapters that he authored are in over 1,500 college libraries in 27 countries. So far over 80,000 copies of the 40 books and monographs that he has authored or co-authored are in print. For more articles by Dr Bergman, see his Author Profile.


*참조 : 인간의 진화 이야기는 실패를 계속하고 있다.

http://creation.kr/Apes/?idx=1852259&bmode=view

사람은 유인원에서 진화했는가?

http://creation.kr/Apes/?idx=1852235&bmode=view

드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?idx=1852224&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

한 화석의 발견으로 또 다시 번복되고 있는 인류 진화 이야기 : 오스트랄로피테쿠스 아나멘시스와 아파렌시스는 공존했다.

http://creation.kr/Apes/?idx=2491152&bmode=view

인류의 조상은 결국 모두 한 종이었다! : 완전히 붕괴되고 있는 인류 진화 계통도

http://creation.kr/Apes/?idx=1852167&bmode=view

원숭이-인간 진화는 신화이다. 

http://creation.kr/Human/?idx=1757436&bmode=view

인간 진화 이야기는 얼마나 일관성이 있는가?

http://creation.kr/Apes/?idx=1851978&bmode=view

당신은 유인원의 후손입니까? 

http://creation.kr/Apes/?idx=1852165&bmode=view

사람은 진화하는 중인가? : 진화라는 단어의 정의에 달려있다.

http://creation.kr/Apes/?idx=1852066&bmode=view


고대 인류의 유물이 섬에서 발견되었다 : 초기 인류(20만 년 전)는 배를 타고 항해를 했다.

http://creation.kr/Apes/?idx=2613754&bmode=view

인류의 조상들은 배를 타고 항해를 할 수 있었다. : 지중해 크레타 섬에서 석기시대(13만 년 전)의 돌연장들이 발견되었다.

http://creation.kr/Apes/?idx=1852101&bmode=view

50만 년 전(?) 조개에 기하학적 무늬가 새겨져 있었다! : 호모 에렉투스는 생각했던 것보다 현명했다?

http://creation.kr/Apes/?idx=1852180&bmode=view

50만 년 전(?) 인류는 돌칼을 만들고 장애아를 돌보았다.

http://creation.kr/Apes/?idx=1852074&bmode=view

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view

독일의 30만 년(?) 전 인류의 거주 장소에서 창, 불의 사용, 난로, 말뼈, 신선한 나무...등이 발견되었다.

http://creation.kr/Apes/?idx=1852191&bmode=view

30만 년 전 독일 석탄 광산에서 발견된 8자루의 창

http://creation.kr/Apes/?idx=1852139&bmode=view

28만 년 전에 인류가 사용했던 창의 발견?

http://creation.kr/Apes/?idx=1852175&bmode=view

130만 년 전(?) 초기 인류는 자원 재활용을 하고 177만 년 전(?) 호모 에렉투스는 이쑤시개를 사용했다. 그리고 음악과 언어에 대한 진화론자들의 공상

http://creation.kr/Apes/?idx=1852169&bmode=view

사람의 불 사용은 알려진 것보다 더 오래됐다. : 70만~100만 년 전에 인류는 불을 사용했다?

http://creation.kr/Apes/?idx=1852161&bmode=view

인류의 열처리 기술은 7~16만 년 전부터 시작됐다? 

http://creation.kr/Apes/?idx=1852089&bmode=view

16만 년(?) 전의 남아프리카인들은 조개구이 파티를 하고 화장품을 사용했다.

http://creation.kr/Apes/?idx=1851988&bmode=view

석기시대에 외과수술이 이루어졌다는 증거가 발견되었다.

http://creation.kr/Apes/?idx=1852099&bmode=view

‘석기시대’ 사람들은 놀랍도록 현대적이었다 : 배를 만들고, 장신구와 화장을 하고, 곡물을 먹고, 구분된 공간을 가졌다. 

http://creation.kr/Apes/?idx=1852106&bmode=view

인류의 조상들은 배를 타고 항해를 할 수 있었다. : 지중해 크레타 섬에서 석기시대(13만 년 전)의 돌연장들이 발견되었다.

http://creation.kr/Apes/?idx=1852101&bmode=view

고대의 방직공장? : 34,000년(?) 전의 고대인들이 만든 섬유가 발견되었다.

http://creation.kr/Apes/?idx=1852060&bmode=view

고대의 페인팅 작업장은 인간의 진화이야기에 도전하고 있다. : 인간의 현대적 사고능력과 인지능력이 10만 년 전부터? 

http://creation.kr/Apes/?idx=1852120&bmode=view


벼랑 끝에 선 인류의 ‘아프리카 기원설’ : 선호되던 인간 진화 이야기는 이제 고군분투하고 있다.

http://creation.kr/Apes/?idx=3630150&bmode=view

인간 진화론의 또 하나의 번복 : 인류의 탄생 장소는 아프리카가 아니라, 유럽이다?

http://creation.kr/Apes/?idx=1852247&bmode=view

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view

유럽에서 발견된 사람 발자국이 80만 년 전의 것이라고?

http://creation.kr/Apes/?idx=1852187&bmode=view


35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://creation.kr/Apes/?idx=1852263&bmode=view

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

330만 년 전으로 주장되는 돌 도구(석기)의 발견으로, 교과서의 인간 진화론은 또 다시 수정되어야만 한다. 

http://creation.kr/Apes/?idx=1852243&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view

고대의 치아 유골이 진화론을 뒤집다. : 40만 년(?) 전 치아는 현대 인류의 치아와 매우 흡사했다.

http://creation.kr/Apes/?idx=1852133&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view


호모 에렉투스(150만 년 전)의 발자국은 현대인의 것과 동일했다.

http://creation.kr/Apes/?idx=1852072&bmode=view

현대인의 발자국과 유사한 150만 년(?) 전 호모 에렉투스의 발자국 

http://creation.kr/Apes/?idx=1852230&bmode=view

라에톨리 발자국은 진화론과 조화되지 않는다 : 366만 년(?) 전의 발자국은 현대인의 것과 유사했다.

http://creation.kr/Apes/?idx=1852118&bmode=view

라에톨리 발자국은 빠르게 침식되고 있는 중이다 : 370만 년 된 발자국이 30년 만에 사라질 위기?

http://creation.kr/Geology/?idx=1290530&bmode=view

라에톨리에서 새로운 사람 발자국들의 발견

http://creation.kr/Apes/?idx=2273260&bmode=view

유럽에서 발견된 사람 발자국이 80만 년 전의 것이라고?

http://creation.kr/Apes/?idx=1852187&bmode=view

수백만 년 전의 완전한 사람발자국의 발견? : 두 발자국에 관한 이야기

http://creation.kr/Apes/?idx=1852025&bmode=view


네안데르탈인은 결국 완전한 사람이었다 : 네안데르탈인의 폐활량은 현생인류보다 더 컸다.

http://creation.kr/Human/?idx=1757435&bmode=view

동굴 벽화를 그렸던 네안데르탈인은 완전한 현생인류였다!

http://creation.kr/Apes/?idx=1852253&bmode=view

네안데르탈인의 유전자 : 진화론자들은 그들이 너무도 틀렸음에 놀라고 있었다.

http://creation.kr/Apes/?idx=1852214&bmode=view

네안데르탈인은 완전한 인간이었음을 확증한 최근의 DNA 연구

http://creation.kr/Apes/?idx=1852147&bmode=view

네안데르탈인 : 답은 진화가 아니라, 후성유전학이다. 

http://creation.kr/Apes/?idx=1852189&bmode=view

네안데르탈인은 시신을 매장하고, 현대인처럼 말할 수 있었다.

http://creation.kr/Apes/?idx=1852173&bmode=view

루마니아의 네안데르탈인은 현대인의 특징들을 가지고 있었다. 

http://creation.kr/Apes/?idx=1852019&bmode=view

네안데르탈인의 피리? 

http://creation.kr/Apes/?idx=1851932&bmode=view

혈거인의 식생활은 원시적이지 않았다 : 네안데르탈인은 채소와 곡식을 요리해서 먹고 있었다.

http://creation.kr/Apes/?idx=1852127&bmode=view

중국에서 현대 인류와 혼합되고 있던 네안데르탈인 

http://creation.kr/Apes/?idx=1852125&bmode=view

네안데르탈인 - 변화되고 있는 실상

http://creation.kr/Apes/?idx=1851954&bmode=view

네안데르탈인 : 자연선택이 아닌 무작위적 유전적 부동 

http://creation.kr/Apes/?idx=1852042&bmode=view

한 네안데르탈인은 현대인에 의해서 찔려 죽었다. 

http://creation.kr/Apes/?idx=1852087&bmode=view

네안데르탈인은 약용식물을 알고 있었다.

http://creation.kr/Apes/?idx=1852153&bmode=view

네안데르탈인은 돌고래를 먹고 있었다.

http://creation.kr/Apes/?idx=1852052&bmode=view

네안데르탈인은 얼굴 화장을 하고 있었다 : 염료로 칠해진 조개 장신구도 발견되었다.

http://creation.kr/Apes/?idx=1852095&bmode=view

한 네안데르탈인은 현대인에 의해서 찔려 죽었다.

http://creation.kr/Apes/?idx=1852087&bmode=view

네안데르탈인은 어디까지나 인간이다! 

http://creation.kr/Apes/?idx=1851883&bmode=view

밝혀진 연대측정의 조작 : 네안데르탈인은 새로운 필트다운인인가? 

http://creation.kr/Apes/?idx=1851948&bmode=view

북극곰과 갈색곰보다 사람과 네안데르탈인이 더 유사하다

http://creation.kr/Apes/?idx=4141087&bmode=view

네안데르탈인이 완전한 현대인이었다는 추가적인 증거

http://creation.kr/Apes/?idx=1851906&bmode=view


출처 : CEH, 2021. 6. 16.

주소 : https://crev.info/2021/06/cave-woman/

번역 : 미디어위원회





미디어위원회
2021-06-09

네안데르탈인은 현생인류와 자주 교배했다.

(Neanderthal-Human Interbreeding Was Frequent)

by Jerry Bergman, PhD

네안데르탈인과 현생인류의 교배는 ‘없었다’에서 ‘자주’로 

네안데르탈인은 잃어버린 고리가 아니라, 다른 인간 그룹이었다.


   네안데르탈인은 진화하지 않았다. 대신에 네안데르탈인에 대한 진화이론은 확실히 진화했다! 수년 동안 이 주제를 추적해오면서, 나는 현생인류가 네안데르탈인과 교배할 수 없었다는 결론의 연구를 기억한다. 왜냐하면 그들은 서로 다른 종이기 때문이라는 것이었다. 대표적인 예가 크링스(Krings) 등의 연구로서, 그들은 다음과 같이 결론을 내렸었다 :

계통발생 분석뿐만 아니라, 인간 mtDNA 염기서열과의 비교에 의하면, 네안데르탈인의 염기서열은 현생인류의 변화 밖에 있다는 것을 보여준다. 더군다나, 네안데르탈인 mtDNA와 현생인류 mtDNA의 공통조상의 연대는 인간 mtDNA의 공통조상의 연대보다 4배나 더 큰 것으로 추정된다... 네안데르탈인은 현생인류에게 mtDNA를 기여하지 못하고 멸종했다.[1]

이 진화론자들은 "네안데르탈인은 현생인류의 유전자 풀에 거의 또는 전혀 기여하지 못했다"라고 잘못 말했던 것이다. 그러한 주장을 하는 진화론자들은 하나가 아니었다. 유전적 분리에 대한 이러한 생각은 "인간의 핵 유전자좌(loci)에서 분자유전학적 변화에 대한 연구로부터 지지를 얻고 있다… 이는 네안데르탈인의 골격과 현생인류의 형태학적 차이의 정도에 대한 평가와 일치한다"고 그들은 말했었다.[2] 즉, “네안데르탈인과 현대인은 구별된 별개의 종”으로서, 서로 교배될 수 없었다는 것이었다.[3] 이러한 아이디어는 많은 생물학 교과서에 채택되었고, 그림으로 설명되어왔다.


새로운 연구는 오래된 견해를 산산조각 냈다

이제 더 자세한 연구는 현대인과 네안데르탈인이 "자주 교배" 했었다는 새로운 견해를 보고하고 있었다.[4] 이 목록에는 현생인류와 "종종 교배"했던 몇몇 미확인 호미닌(hominins) 뿐만 아니라, 데니소바인(Denisovans)도 추가되고 있었다.[5] 이제 상호교배가 불가능했다는 주장은, 자주 교배했다는 견해로 바뀌고 있었는데, 이러한 결론은 “인류가 언제, 어디에서 왔는지에 대한 진화인류학자들의 그림을 산산조각 내고 있었다"는 것이다.[6] 최근 Nature 지(2021. 4. 7)에 게재된 하지딘자크(Hajdinjak) 등의 논문은 같은 날 Science News의 브루스 바워(Bruce Bower)에 의해서 요약되었다. 그들의 연구는 다음에 기초하고 있었다 :

(이 연구의 결과는) 방사성탄소 연대측정 결과 약 43,000년에서 46,000년 전으로 평가된 치아와 두 뼈에서 나온 고대 DNA로부터 얻어졌다. 화석이 발굴된 퇴적층과 같은 퇴적층에서 후기 석기시대(late Stone Age) 인간의 전형적인 돌연장이  발견되었다... 고대 이종교배에 대한 더 많은 증거는 1950년 현재의 체코공화국에 있던 동굴에서 발견된 거의 완전한 인간의 두개골에서 온 것이다.[7]

선도적 저널인 Nature 지에 게재된 이 연구는 미토콘드리아 DNA(mitochondrial DNA)의 유전체인, 198개의 미토게놈(mitogenomes)에 기초한 것이다.[8] 미토콘드리아 DNA는 여성에게만 전달되는 유전정보이다. 미토콘드리아 내부에서 발견되는 작은 원형의 염색체인 미토콘드리아 DNA는 난자를 통해서 모체로부터 자손으로 독점적으로 전달된다. 정자(sperm)의 머리에는 미토콘드리아가 없으며, 따라서 미토콘드리아와 미토콘드리아 DNA의 유일한 원천은 모체의 난세포이다. 모든 진핵세포에 존재하는 이 미토콘드리아 세포기관은 세포의 주 에너지원인 ATP를 만들기 때문에, 세포의 발전소이다. 게다가 그 연구는 다음과 같이 결론내리고 있었다 :

호모 사피엔스(Homo sapiens)와 네안데르탈인 사이의 교배는 흔히 가정됐던 것보다 더 흔하게 일어났다... [그리고] 호모 사피엔스와 네안데르탈인이 종종 교배했다면… 비교적 많은 수의 인간 후손들이 소규모 네안데르탈인 그룹으로부터 예기치 않은 DNA를 축적했을 것이다... 40,000년 전 이후에 네안데르탈인 혈통이 거의 없거나, 전혀 없었던 사람들의 유럽으로 추가적 이주는 인간 유전자 풀에서 네안데르탈인 DNA를 더욱 희석시킬 수 있었을 것이다... 네안데르탈인은 지금까지 발견된 모든 사람 집단과 교배하여, 그들의 유전자 일부가 오늘날 우리의 DNA에서 살아남아 있는 것이다.[9]

예상치 못했던 이러한 결론은 인간 진화론에 대한 정통적 견해와 근본적으로 모순된다. 한 세기 이상 동안 교과서는 현생인류가 매우 많은 초기 인류의 후손이라고 가르쳐왔다. 그 집단들은 수십 수만 년 동안 자연선택에 의해서 도태되었고, 결국 현대인으로 이어졌다고 그들은 말해왔다. 네안데르탈인을 포함한 인류 진화나무의 많은 가지들이 멸종되었고, 데니소바인(Denisovans)과 덜 성공적이지 못했던 인간 이전의 가지들 또한 멸종되었다. 결과적으로, 현생인류와 네안데르탈인이 교배했었다는 새로운 연구는 인간 진화계통나무에서 묘사됐던, 거의 한 세기에 걸친 인간 진화론을 뒤집어엎는 것이기 때문에, 몇몇 인류학자들은 이 새로운 연구를 받아들이기를 꺼려하고 있다.


다른 유전적 염기서열 측정도 진화론을 산산조각 냈다.

또한 유전자 시퀀싱(genetic sequencing)은 다른 방법으로도 우리가 어디에서 왔는지와 언제 왔는지에 대한 우리의 관점을 혁명적으로 바꾸어 놓는다는 것이다. 한 보고서는 "오늘날 살아있는 모든 사람은 약 20만 년 전 보츠와나에 살았던 한 여성에게서 유래했다"고 결론짓고 있었다.[10] 이 발견은 인간 진화론에서 오랫동안 유행해왔던 "관목숲 그림(bush picture)"을 파괴하는 것이다. 이 새로운 견해는 2008년 10월 내셔널 지오그래픽의 커버스토리로 등장했었다.


요약

mtDNA와 DNA에 기초한 연구는 네안데르탈인이 현생인류와 교배했다는 것을 증명함으로써, 소위 동굴인(caveman)이라는 관점을 파괴시켰다. 따라서 지난 세기 동안 교과서와 진화론 문헌에서 기술됐던 것과 같이 네안데르탈인은 현생인류와 별도의 종이 아니었다. 이것은 경험적 연구가 진화론에 기초한 핵심 개념을 부정해버린 또 하나의 사례이다. 네안데르탈인은 현대의 인류로 이어지는 ‘잃어버린 고리’가 아니었고, 현재 "현생인류(modern humans)"라고 불리는 다른 인간 집단과 결혼할 수 있었고, 결혼했던 또 다른 인류 집단이었다.


References

[1] Krings, Matthias, et al., Neanderthal DNA sequences and the origin of modern humans, Cell 90(1):19-30, 11 July 1997, p. 19.

[2] Krings, et al., 1997, p. 27.

[3] Krings, et al., 1997, p. 27.

[4] Bower, Bruce, Europe’s oldest known humans mated with Neandertals surprisingly often. Bower, Bruce,  2021. Neanderthals and Humans Mated Often  Science News, 8 May 2021, p. 7.

[5] Woodward, Aylin, A handful of recent discoveries have shattered anthropologists’ picture of where humans came from, and when, Business Insider, 5 January 2020.

[6] Woodward, 2020, p. 1.

[7] Hajdinjak. M., et al., Initial Upper Paleolithic humans in Europe had recent Neandertal ancestry, Nature 592: 253-257, Published online 7 April 2021. DOI: 10.1038/s41586-021-03335-3.

— Prüfer, K., et al., A genome sequence from a modern human skull over 45,000 years old from Zlatý kůň in Czechia, Nature Ecology & Evolution. Published online 7 April 2021. DOI: 10.1038/s41559-021-01443-x.

[8] Chan, Eva K., and 12 co-authors, Human origins in a southern African paleo-wetland and first migrations, Nature 575:185–189, 28 October 2019.

[9] Bower, 2021, p 7.

[10] Woodward, Aylin, Every person alive today descended from a woman who lived in modern-day Botswana about 200,000 years ago, a new study finds, Business Insider, 28 October 2019.

*Dr. Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology for over 40 years at several colleges and universities including Bowling Green State University, Medical College of Ohio where he was a research associate in experimental pathology, and The University of Toledo. He is a graduate of the Medical College of Ohio, Wayne State University in Detroit, the University of Toledo, and Bowling Green State University. He has over 1,300 publications in 12 languages and 40 books and monographs. His books and textbooks that include chapters that he authored are in over 1,500 college libraries in 27 countries. So far over 80,000 copies of the 40 books and monographs that he has authored or co-authored are in print. For more articles by Dr Bergman, see his Author Profile.


*참조 : 네안데르탈인은 결국 완전한 사람이었다 : 네안데르탈인의 폐활량은 현생인류보다 더 컸다.

http://creation.kr/Human/?idx=1757435&bmode=view

동굴 벽화를 그렸던 네안데르탈인은 완전한 현생인류였다!

http://creation.kr/Apes/?idx=1852253&bmode=view

네안데르탈인의 유전자 : 진화론자들은 그들이 너무도 틀렸음에 놀라고 있었다.

http://creation.kr/Apes/?idx=1852214&bmode=view

네안데르탈인은 완전한 인간이었음을 확증한 최근의 DNA 연구

http://creation.kr/Apes/?idx=1852147&bmode=view

네안데르탈인 : 답은 진화가 아니라, 후성유전학이다. 

http://creation.kr/Apes/?idx=1852189&bmode=view

네안데르탈인은 시신을 매장하고, 현대인처럼 말할 수 있었다.

http://creation.kr/Apes/?idx=1852173&bmode=view

루마니아의 네안데르탈인은 현대인의 특징들을 가지고 있었다. 

http://creation.kr/Apes/?idx=1852019&bmode=view

네안데르탈인의 피리? 

http://creation.kr/Apes/?idx=1851932&bmode=view

혈거인의 식생활은 원시적이지 않았다 : 네안데르탈인은 채소와 곡식을 요리해서 먹고 있었다.

http://creation.kr/Apes/?idx=1852127&bmode=view

중국에서 현대 인류와 혼합되고 있던 네안데르탈인 

http://creation.kr/Apes/?idx=1852125&bmode=view

네안데르탈인 - 변화되고 있는 실상

http://creation.kr/Apes/?idx=1851954&bmode=view

네안데르탈인 : 자연선택이 아닌 무작위적 유전적 부동 

http://creation.kr/Apes/?idx=1852042&bmode=view

한 네안데르탈인은 현대인에 의해서 찔려 죽었다. 

http://creation.kr/Apes/?idx=1852087&bmode=view

네안데르탈인은 약용식물을 알고 있었다.

http://creation.kr/Apes/?idx=1852153&bmode=view

네안데르탈인은 돌고래를 먹고 있었다.

http://creation.kr/Apes/?idx=1852052&bmode=view

네안데르탈인은 얼굴 화장을 하고 있었다 : 염료로 칠해진 조개 장신구도 발견되었다.

http://creation.kr/Apes/?idx=1852095&bmode=view

한 네안데르탈인은 현대인에 의해서 찔려 죽었다.

http://creation.kr/Apes/?idx=1852087&bmode=view

네안데르탈인은 어디까지나 인간이다! 

http://creation.kr/Apes/?idx=1851883&bmode=view

밝혀진 연대측정의 조작 : 네안데르탈인은 새로운 필트다운인인가? 

http://creation.kr/Apes/?idx=1851948&bmode=view

북극곰과 갈색곰보다 사람과 네안데르탈인이 더 유사하다

http://creation.kr/Apes/?idx=4141087&bmode=view

네안데르탈인이 완전한 현대인이었다는 추가적인 증거

http://creation.kr/Apes/?idx=1851906&bmode=view

Time 지 기사 번역 모음 2 : 네안데르탈인의 미스테리

http://creation.kr/Apes/?idx=1851902&bmode=view

루마니아의 네안데르탈인은 현대인의 특징들을 가지고 있었다.

http://creation.kr/Apes/?idx=1852019&bmode=view

진화 역전 : 네안데르탈인이라는 분류군은 없다?

http://creation.kr/Apes/?idx=1852007&bmode=view


출처 : CEH, 2021. 5. 31. 

주소 : https://crev.info/2021/05/neanderthal-interbreeding-frequent/

번역 : 미디어위원회

미디어위원회
2021-06-03

진화론은 증거와 맞지 않는다.

: 진화론자들도 인간 진화는 대혼란이라고 말한다. 

(Darwinism Does Not Fit the Evidence)

David F. Coppedge


     진화론자들은 "진화의 증거는 압도적"이라고 말하며, 거짓말을 해왔다. 그러나 그 반대가 사실이다.

진화론자들이 대중에게 말할 때, 그들은 진화론이 의심할 여지없이 사실(fact)이라고 과장한다. 그러나 그들끼리 이야기할 때는, 그들의 이론을 뒷받침한다는 증거들에 대해서 한탄하고 있었다. 아래는 이번 달(2021년 5월)에 보도된 몇 가지 사례이다.


유전학적 충돌

계통발생학적 데이터 분석은 조류(avian)의 진화계통나무에서 서로 충돌하고 있다는 것이다.(bioRxiv 2021. 5. 18). 논문의 저자들에는 저명한 진화론자인 조엘 크래크래프트(Joel Cracraft)와 스티븐 스미스(Steven A. Smith)도 포함되어 있었다. 요약한 내용은 다음과 같다 :


▶ 유전학적 증거들에 의한 계통발생학적 연구는 자주 진화계통나무의 패턴과 일치하지 않는다.

▶ 전체 유전체 연구도 실패하고 있다. 이 경우에 데이터 부족을 탓할 수도 없다.

▶ 진화계통나무에서 "논쟁적" 지점을 많이 들여다볼수록, 문제는 더 커진다.

▶ 그들은 데이터에서 노이즈(noise)를 탓할 수도 없다. 노이즈가 발생하더라도, 일부 불일치는 실제 생물학적 사실을 반영한다.

▶ 5명의 저자들은 조류 종에 대한 분자적 증거를 조사했지만, 충돌을 해결할 수 없었다.

▶ 가장 문제가 되는 불일치를 제거한다 하더라도, 충돌은 여전했다.

▶ 그들은 조류에서 어떠한 유전자를 살펴보든지 불일치를 관측했다.

▶ 날개에 발톱이 있는 수수께끼 새인 호아친(Hoatzin)은 어떻게 바닷새와 가장 가까울 수 있을까?

▶ 조류의 계통발생학적 불일치는 "이전 연구 결과보다 더 클 수 있다"


‘지속적인 긍정적 선택 하에서 단백질 진화의 돌연변이-자연선택 모델’이라는 제목의 논문이 발표되었다.(Tamuri and dos Reis in bioRxiv). 이 논문은 "긍정적 선택(positive selection)"의 측정에 결함이 있음을 보여주고 있었다. 그들은 돌연변이와 자연선택에 의한 "단백질 진화"에 대한 연구에서, 지속적으로 작동되는 긍정적 선택(persistent positive selection)을 조사해보았다. 그들은 dN/dS(비대칭 대 대칭 치환, 기호로는 ω)의 비율이 '임의적'이라고 말한다. 왜냐하면, "실제 단백질에서 많은 돌연변이들은 매우 해롭고(highly deleterious), 심지어 긍정적 선택 부위에서도 선택에 의해 제거되기 때문“이라는 것이다. 그럼에도 불구하고, ω는 "긍정적 선택"에 대한 연구에서 많이 사용되고 있는 척도이다. (왜냐하면 그것은 발전의 신호일 수 있어서, 중요한 종류의 자연선택으로 간주되고 있기 때문이다. 참조, 2 Sept 2019). 


화석 충돌

‘화석 유인원과 인간 진화’(Almécija and 5 others, Science, 7 May 2021, Vol. 372, Issue 6542, eabb4363, DOI: 10.1126/science.abb4363)라는 제목의 논문이 Science 지에 게재됐다. 과학자들이 발굴한 유인원 화석들과 인간 화석들은 일관된 진화 이야기로 이어지지 않는다는 것이다. 스페인과 미국 자연사박물관(AMNH)의 저자들은 증거들은 유인원들 중에서 인간과 가장 가까운 친척이 침팬지라는 것을 부정하고 있었다.

다윈과 헉슬리의 저술 이후, 유인원(apes, nonhuman hominoids)과 사람의 친척 관계와 인간 계통((hominins)의 지리학적 기원에 대한 많은 논의가 있어왔다 … "하향적(top-down)" 접근 방식은 호미닌의 기원을 구축하기 위해서 살아있는 유인원(특히 침팬지)에 의존해 왔다. 그러나 화석기록으로부터의 "상향적" 관점은 현대의 호미노이드들이 고대의 커다란 방산(radiation)으로 소멸된 편향적인 표본을 나타내며, 범-호모 LCA(Pan-Homo last common ancestor)의 형태학과 지리학에 대한 대안적 가능성을 제시하고 있다. 이 두 가지 관점을 조정하는 것이 인간 기원 문제의 핵심으로 남아 있다.


결론 부분에서, 그들은 화석들이 진화 이야기에 정보를 주고 있음에는 틀림없지만, 인간 진화 이야기에는 "제한과 간격"들이 있다는 것이다. 화석의 부족이 문제가 아니라, 화석기록은 유인원에서 인간으로 가는 명확한 길을 지지하지 않고 있다는 것이다. 마지막 두 단락은 그들의 동료 진화론자들에 대한 당혹스런 질책을 담고 있었다 :

인간은 이야기꾼(storytellers)이다. 인간의 진화이론은 직립자세의 기원, 손의 자유로운 사용, 뇌의 확장과 같은, 필수적인 측면을 설명하기 위하여, 한 영웅의 여정을 차용한 ‘인류 발생 이야기(anthropogenic narratives)’와 종종 닮았다. 흥미롭게도, 그러한 이야기들은 다윈의 시대 이후로 크게 바뀌지 않았다. 우리는 기존의 이야기 내에서 새로운 화석에 주연 역할(starring role)을 부여하려는, 연구자들에서 일어나는 확증편향(confirmation biases)과 임시방편적 해석(ad hoc interpretations)에 대해 알아야만 한다. 진화 시나리오는 현재의 지식을 바탕으로 그럴듯한 설명을 제공하기 때문에 매력적이지만, 검증 가능한 가설에 근거하지 않는 한, '그랬을 것이라는 이야기'에 지나지 않는다.

화석 유인원들에 대한 많은 불확실성들이 지속되고 있어서, 멸종된 종들에 대한 고생물학적 구축이 확실히 이루어질 수 있는 날은 아직도 멀었다...

찰스 콜슨 센터(Charles Colson Center)의 기독교 변증학 해설가인 존 스톤스트리트(John Stonestreet)는 2021년 5월 17일 그의 브레이크포인트 논평에서(여기를 클릭) 진화론자들의 이러한 입장에 대해 쓰고 있었다. 아이러니하게도 다윈의 두 번째 저서 "인간의 유래"(1871)의 출간 150주년을 맞아, 진화론자들은 인간 진화의 화석들은 "대혼란(mess, 엉망진창)"임을 인정하고 있다는 것이다.


그러나 Science 지의 논문을 리뷰한 미국 자연사박물관(AMNH)의 보도자료는 매우 오해의 소지가 있는 헤드라인을 달고 있었다. "리뷰 : 화석 유인원 연구는 인간 진화 연구에서 열쇠이다“. 맨 위에 있는 커다란 그림은 유인원의 머리가 사람의 머리와 앞뒤로 연결되어 있음을 보여준다. 첫 인상은 진화론자들이 인간의 기원을 알아내는데 있어서 영웅적인 진전을 이루고 있다는 느낌을 준다. 뒷부분에 가서야 선임저자의 말을 인용하고 있었다 :

"호미닌의 기원에 대한 이야기는 대혼란 그 자체이고, 일치된 견해가 없다." 미국 자연사박물관 인류학 분과의 수석연구원이자, 리뷰 글의 주 저자인 세르지오 알메시자(Sergio Almécija)는 말했다. “사람들은 완전히 다른 패러다임 하에서 연구하고 있는데, 이러한 일은 다른 어떠한 과학 분야에서도 일어나지 않는 일이다."

1871년 찰스 다윈은 그의 책 ‘인간의 유래’에서, 인간은 다른 어떤 생물 종들과는 다른 한 조상으로부터 아프리카에서 기원했다고 추측했다. 그러나 당시 화석들이 부족했던 점을 감안할 때, 그는 조심스러운 태도를 보였다"고 알메시자는 말했다. "150년이 지난 후, 인간-침팬지의 분기 시기에 호미닌이 동부 아프리카와 중부 아프리카에서 발견되었고, 어떤 이들은 심지어 유럽에서도 발견되었다고 주장했다. 게다가, 현재 아프리카와 유라시아 전역에 걸쳐, 50여개 이상의 화석 유인원 속(fossil ape genera)들이 기록되어 있다. 그러나 이 화석들 중 많은 것들은 오늘날의 유인원과 인간 계통의 고대인들에 대한 예측과 일치되지 않는, 서로 혼합된 모자이크 특성을 보여준다. 그 결과, 이들 화석 유인원들의 진화적 역할에 대한 과학적 합의는 이루어지지 않고 있다."

다음의 문장은 인간 진화론 연구의 문제점을 요약해주고 있었다 : "종합적으로, 인간의 기원에 대한 대부분의 이야기들은 오늘날 우리가 갖고 있는 화석들과 조화되지 않는다는 것을 연구자들은 발견했다." 진화론자들은 데이터에서 문제점이 드러날 때, 그것을 인정하면서 언젠가 미래에는 해결책이 나올 것으로 희망한다. 저자들은 그 논문의 ‘전망(Outlook)’ 섹션에서 그들의 동료들에 대해 강력한 타격을 가하고 있었다 : "실험해볼 수 없는 가설에 기초하고 있는 진화 시나리오에 맞추기 위해서, 새로 발견된 각각의 화석들에 주연 역할을 부여하는 일은 반드시 중단되어야 한다."

진화론자들은 대게 진화론의 문제점은 잘 인정하지 않는다. 그들이 이 정도로 인간 진화론의 문제점을 인정한다는 것은 그 문제가 정말로 심각하다는 것을 뜻한다.

-----------------------------------------------

더 이상 질문 없는가? 우리가 말하지 않아도, 진화론자들 스스로가 그들의 문제점을 자백하고 있었다.


*참조 : 인간의 진화 이야기는 실패를 계속하고 있다.

http://creation.kr/Apes/?idx=1852259&bmode=view

사람은 유인원에서 진화했는가?

http://creation.kr/Apes/?idx=1852235&bmode=view

드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?idx=1852224&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

한 화석의 발견으로 또 다시 번복되고 있는 인류 진화 이야기 : 오스트랄로피테쿠스 아나멘시스와 아파렌시스는 공존했다.

http://creation.kr/Apes/?idx=2491152&bmode=view

인류의 조상은 결국 모두 한 종이었다! : 완전히 붕괴되고 있는 인류 진화 계통도

http://creation.kr/Apes/?idx=1852167&bmode=view

원숭이-인간 진화는 신화이다. 

http://creation.kr/Human/?idx=1757436&bmode=view

인간 진화 이야기는 얼마나 일관성이 있는가?

http://creation.kr/Apes/?idx=1851978&bmode=view

당신은 유인원의 후손입니까? 

http://creation.kr/Apes/?idx=1852165&bmode=view

사람은 진화하는 중인가? : 진화라는 단어의 정의에 달려있다.

http://creation.kr/Apes/?idx=1852066&bmode=view

고대 인류의 유물이 섬에서 발견되었다 : 초기 인류(20만 년 전)는 배를 타고 항해를 했다.

http://creation.kr/Apes/?idx=2613754&bmode=view

인류의 조상들은 배를 타고 항해를 할 수 있었다. : 지중해 크레타 섬에서 석기시대(13만 년 전)의 돌연장들이 발견되었다.

http://creation.kr/Apes/?idx=1852101&bmode=view

50만 년 전(?) 조개에 기하학적 무늬가 새겨져 있었다! : 호모 에렉투스는 생각했던 것보다 현명했다?

http://creation.kr/Apes/?idx=1852180&bmode=view

50만 년 전(?) 인류는 돌칼을 만들고 장애아를 돌보았다.

http://creation.kr/Apes/?idx=1852074&bmode=view

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view

독일의 30만 년(?) 전 인류의 거주 장소에서 창, 불의 사용, 난로, 말뼈, 신선한 나무...등이 발견되었다.

http://creation.kr/Apes/?idx=1852191&bmode=view

30만 년 전 독일 석탄 광산에서 발견된 8자루의 창

http://creation.kr/Apes/?idx=1852139&bmode=view

130만 년 전(?) 초기 인류는 자원 재활용을 하고 177만 년 전(?) 호모 에렉투스는 이쑤시개를 사용했다. 그리고 음악과 언어에 대한 진화론자들의 공상

http://creation.kr/Apes/?idx=1852169&bmode=view

사람의 불 사용은 알려진 것보다 더 오래됐다. : 70만~100만 년 전에 인류는 불을 사용했다?

http://creation.kr/Apes/?idx=1852161&bmode=view

‘석기시대’ 사람들은 놀랍도록 현대적이었다 : 배를 만들고, 장신구와 화장을 하고, 곡물을 먹고, 구분된 공간을 가졌다. 

http://creation.kr/Apes/?idx=1852106&bmode=view

인류의 조상들은 배를 타고 항해를 할 수 있었다. : 지중해 크레타 섬에서 석기시대(13만 년 전)의 돌연장들이 발견되었다.

http://creation.kr/Apes/?idx=1852101&bmode=view

벼랑 끝에 선 인류의 ‘아프리카 기원설’ : 선호되던 인간 진화 이야기는 이제 고군분투하고 있다.

http://creation.kr/Apes/?idx=3630150&bmode=view

인간 진화론의 또 하나의 번복 : 인류의 탄생 장소는 아프리카가 아니라, 유럽이다?

http://creation.kr/Apes/?idx=1852247&bmode=view

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://creation.kr/Apes/?idx=1852263&bmode=view

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

330만 년 전으로 주장되는 돌 도구(석기)의 발견으로, 교과서의 인간 진화론은 또 다시 수정되어야만 한다. 

http://creation.kr/Apes/?idx=1852243&bmode=view

그리스에서 570만 년 된 사람 발자국의 발견? : 트라칠로스의 발자국으로 다시 써야하는 인류 진화론 

http://creation.kr/Apes/?idx=1852249&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view

고대의 치아 유골이 진화론을 뒤집다. : 40만 년(?) 전 치아는 현대 인류의 치아와 매우 흡사했다.

http://creation.kr/Apes/?idx=1852133&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view

호모 에렉투스(150만 년 전)의 발자국은 현대인의 것과 동일했다.

http://creation.kr/Apes/?idx=1852072&bmode=view

현대인의 발자국과 유사한 150만 년(?) 전 호모 에렉투스의 발자국 

http://creation.kr/Apes/?idx=1852230&bmode=view

라에톨리 발자국은 진화론과 조화되지 않는다 : 366만 년(?) 전의 발자국은 현대인의 것과 유사했다.

http://creation.kr/Apes/?idx=1852118&bmode=view

수백만 년 전의 완전한 사람발자국의 발견? : 두 발자국에 관한 이야기

http://creation.kr/Apes/?idx=1852025&bmode=view

유럽에서 발견된 사람 발자국이 80만 년 전의 것이라고?

http://creation.kr/Apes/?idx=1852187&bmode=view


출처 : CEH, 2021. 5. 18.

주소 : https://crev.info/2021/05/darwinism-does-not-fit-the-evidence/

번역 : 미디어위원회

미디어위원회
2021-05-17

진화론자들의 우스꽝스러운 뇌 진화 이론들

(Brain Evolution Theories Earn Dunce Caps)

David F. Coppedge


     진화론자들은 인간의 뇌를 설명하기 위해 다윈의 방법을 시도할 때, 비논리적인 사람들이 된다.

"유인원(apes)은 끊임없이 바퀴를 재창조해야 했다." 튀빙겐 대학(University of Tübingen, 2021. 3. 29)의 보도 자료를 읽어보라. 물론 원숭이는 바퀴를 발명하지 않았다. 그랬다면 수백만 년의 진화 과정을 거쳐 지금은 테슬라를 운전하고 있을 것이다. 그 보도 자료가 의미하는 것은 원숭이들은 그들의 지식을 다른 원숭이들에게 가르치거나 물려줄 수 없다는 것이다. 그 기사는 "인간과 달리, 유인원은 서로의 노하우를 전달받지 못하고, 각 개체와 각 세대에서 각각의 행동을 반복적으로 다시 만들어내야 한다"고 말한다. 진화론자들은 인간과 유인원의 이러한 차이를 어떻게 설명할까? 여기 최근의 시도들이 있다.


인간이 지배적 종이 된 진정한 이유(BBC News, 2021. 3. 28). 저스틴과 로렌스(Justin Rowlatt and Laurence Knight)는 인간만이 예외라고 말하고 있었다. 그들은 인간의 몸은 밝은 백열전구와 같은 약 90와트의 에너지로 움직인다고 생각하라고 말하고 있었다.

하지만 선진국의 사람은 평균 그 100배 이상을 사용하고 있다. 만약 여러분이 주변을 돌아다니고, 집을 짓고, 음식을 만들고, 식물을 재배하고, 할 수 있는 모든 것들을 하고 있다면 말이다.

어떻게 90와트로 움직이는 존재가 10,000와트를 소비하게 되었을까? 누군가는 인간은 에너지를 만드는 방법을 생각하고, 그 에너지로 기계들을 작동시키는, 인간의 지능과 창의력 때문이라고 생각할지 모른다. 그러나 그것은 다윈을 칭송하는 이야기를 지어내는 진화론자들의 창의성을 과소평가한 것이다.

"생물체가 에너지를 더 효율적으로 얻게 하는 것은, 그 생물체의 진화 궤도에 커다란 영향을 미칠 것이다"라고 하버드 대학의 레이첼 카모디(Rachel Carmody) 교수는 설명한다.

카모디와 그녀의 동료들은 여분의 에너지를 믿고 있었고, 그것이 인간을 영장류 사촌들과 구별되게 만들어주었고, 상대적으로 크고 에너지 소모가 많은 뇌와 작은 창자를 진화시킬 수 있게 해주었다고 믿고 있었다.

카모디는 일단 뇌가 커지기 시작하면서 "긍정적인 피드백 고리"를 만들어냈고, 에너지를 필요로 하는 커다란 뇌를 진화시켰을 것이라고 생각하고 있었다. 만약 인간이 유인원 조상을 가지고 있었다면, 매번 그러한 기관을 재발명해야 했을 것이고, 프로젝트는 성공하지 못했을 것이다.


미니 뇌들은 왜 인간의 뇌가 다른 유인원의 뇌보다 더 크게 자라나는지를 보여준다.(New Scientist, 2021. 3. 24) 여러분은 주의 깊게 그 글을 읽어보라. New Scientist 지는 인간을 유인원과 동급으로 취급하고 있었다! 기분 나쁘지 않은가? 기사를 쓴 카리나(Karina Shah)는 인종차별주의자인가? 그녀는 영국 케임브리지 대학 분자생물학 연구소에서 수행된 한 실험에 대해 쓰고 있었다. 그곳에서 연구자들은 만능줄기세포로부터 뇌 ‘오가노이드(organoids, 장기유사체)‘를 배양했다. 인간의 뇌 오가노이드는 5주 안에 유인원의 뇌 오가노이드의 두 배만큼 커졌다. 이러한 실험이 윤리적인지 아닌지는 또 다른 문제이지만(2021. 3. 20. 참조), 그들에게 중요한 것은 오직 크기였다. 이것은 매우 불합리한 추론이고, 비논리적 추론이다. 코끼리의 뇌와 고래의 뇌는 둘 다 매우 크다. 그러나 그 동물들이 테슬라를 몰고 다니지 않는다. 작은 사람들이 큰 사람보다 현명하고 똑똑할 수 있다. 확실히 질적 차이는 양적 차이보다 더 중요하다. 카리나는 심지어 영적인(spiritual) 차이를 고려하지 않고 있었다. 분명히 그러한 고려는 그녀의 물질적-세계관을 벗어나는 일일 것이다.

UK Research and Innovation(2021. 3. 24)의 보도 자료도 참조하라. 매들린 랭카스터(Madeline Lancaster) 박사는 "세포 형태의 비교적 단순한 진화적 변화가 뇌 진화에 주요한 결과를 가져올 수 있다는 것은 놀라운 일이다"라고 말했다. (이 인종차별적 보도자료 또한 당신을 유인원이라고 부르고 있었다.) 그러나 단지 뇌 세포의 크기와 모양이 중요한 것이라면, 슈퍼컴퓨터를 얻기 위해서 커다란 컴퓨터 칩을 사용해야 하는가? 아니다. 컴퓨터의 기능은 그 안에 내장된 소프트웨어와 관련이 있다.


뇌의 진화는 우리의 인지 과정이 과학기술로 확장되도록 했을 수 있다(CENIEHSpain). 이것은 추정되는 진화 과정 동안, 인간 두개골의 형태에 초점을 맞춘 변형된 뇌의 형태 이론이다. 그것은 일종의 골상학(phrenology)처럼 들린다.(see 4 January, 2021).

스페인 국립 인류진화연구센터(CENIEH)의 연구원인 에밀리아노 브루너(Emiliano Bruner)는 플레이스토세 중기(Middle Pleistocene)동안, 인간 뇌의 진화에 대한 리뷰 논문을 발표했는데, 이 글은 뇌-두개골의 해부학적 요소 사이의 공간적 관계를 분석한 모델과 함께, 고신경학(paleoneurology)과 기능적 두개학(craniology)에 대한 전망을 제공하고 있다. 

.중요한 것은 두개골의 크기가 아니라, 내용물이다.


무엇이 인간의 뇌가 커지도록 자극했을까? 논란의 여지가 있는 논문은 새로운 가설을 제안하고 있다.(Live Science). 중요한 것은 크기나 모양이 아니었다고, Live Science 지에서 스테파니 파파스(Stephanie Pappas)는 말한다. 중요한 것은 내용물이었다. 코끼리가 그들의 뇌를 키우고 있을 때에, 사람은 그들의 살코기 컴퓨터(meat computers)를 위한 단백질들을 얻기 위해서, 작은 동물들을 사냥해야 했다.

260만~11,700년 전 사이의 플라이스토세 시대가 진행되는 동안, 인간과 그 친척들의 뇌는 커졌다. 이제 텔아비브 대학의 과학자들은 그 이유에 대해 새로운 가설을 갖고 있었다 : 가장 큰 동물들이 사라지면서, 인간의 뇌는 더 작고 빠른 먹이를 사냥하기 위해서 커져야만 했다고 과학자들은 제안한다.

당신도 알다시피, 사람의 뇌는 커져야만 했다. 진화론은 그것을 강요한다. 그렇지 않았다면, 작은 뇌의 인간들은 굶어 죽었을 것이라는 것이다. 같은 일이 치타에게는 왜 일어나지 않았는가? 진화론자들은 '만물 우연발생의 법칙'을 믿고 있기 때문에, 무슨 일이라도 일어날 수 있다.

다행히도, 파파스는 이 이론에 대한 비판자들의 의견도 언급하고 있었는데, 이 이론은 너무 단순하고 증거가 부족하다는 것이다 ; 예를 들어, 인도네시아의 호빗인들은 작은 뇌를 가졌지만, 커다란 뇌를 가진 코끼리와 작은 설치류들을 사냥했다. 비판가들은 파파스의 이야기에 대해 의구심을 갖고 있었지만, 그들의 대안도 여전히 진화론에 기초한 것이었다. 다른 우연한 일이 일어났다는 것이다.

인간과 그들의 친척들이 뇌의 커짐을 경험한 기간은 화석기록으로 거의 남아있지 않기 때문에 잘 이해되지 않고 있다. 예를 들어, 아마도 30만~40만 년 전 사이로 평가되는, 인간과 그들의 조상과 관련이 있는 서너 개의 장소가 아프리카에 있었다고, 이 연구에 참여하지 않았던, 그 결론에 회의적인 위스콘신-매디슨 대학의 고인류학자인 존 호크스(John Hawks)는 말했다. 플라이스토세(Plistocene) 동안 인간의 진화 가계도는 많은 가지들을 가진 채로 복잡하게 얽혀 있고, 뇌 크기의 커짐은 선형적이지 않다. 호크스는 Live Science 지에서 말했다.

논란이 된 이 이론의 제안자는 미키 벤-도(Miki Ben-Dor)와 텔아비브 대학(Tel Aviv University)의 란 바카이(Ran Barkai) 교수이다. 언론 보도는 남성 사냥꾼들보다 더 활발하게 코끼리를 사냥하는, 상의가 없는 여성 사냥꾼들을 함께 묘사하고 있었다. 어떤 정치적 성향이 내포되어 있는 것일까? 여성들도 남성들과 같이 사냥을 할 수 있음을 강조하는 것일까? 아니면 여성스포츠에 남성들이 참여하고 있었던 것일까?


플린더스 대학의 연구자들은 마침내 약간의 겸손함을 보여주었다.(Phys.org, 2021. 3. 31). 그들은 유대류(marsupials)를 연구한 후, 뇌의 크기가 동물의 어떤 행동이나 특성과 상관관계가 있다는 증거를 찾을 수 없었다는 것이다. 그들의 결과는, 큰 뇌는 성장과 유지를 위해 더 많은 에너지를 필요로 하며, 지능과 상관관계가 있다는 일반적인 개념을 부정하고 있었다.

"이것은 우리가 커다란 뇌를 갖기 위한 비용에 많은 주의를 기울일 필요가 있다는 흥미로운 증거이다. 불행하게도 이것은 포유류의 진화에서, 커다란 뇌를 갖도록 야기했던 것이 무엇인지를 이해하는데 아직 갈 길이 멀다는 것을 의미한다"라고 올린(Orlin S.)은 말했다.

공동저자인 베라 웨이스베커(Vera Weisbecker)는 덧붙였다. "뇌 크기와 지능 사이의 관계에 대해 얼마나 아는 것이 없는지에 대해 솔직하게 말할 필요가 있다. 현재까지, 상대적으로 커다란 뇌가 더 똑똑하다는 것을 확인할 수 있는 실질적인 방법은 없다". 이들의 연구결과는 Proceedings of the Royal Society B(2021. 3. 31) 지에 게재되었다.

--------------------------------------------------


이스라엘의 과학자들이 그들의 바알인 다윈을 숭배하기 위해 논리적인 생각을 포기하고, 우스꽝스러운 살코기 컴퓨터 이론을 주장하는 것을 보는 일은 슬픈 일이다. 그들은 그들의 조상들이 믿었던 하나님을 포기하고, ‘만물 우연발생의 법칙’을 만고의 진리로 믿고 있다. 그들이 회개하지 않고 약속된 메시아를 받아들이지 않는다면, 그들의 운명은 갑작스런 파멸을 맞이할 것이다. 

이 이론들 중 어느 것도 인간만의 특별함, 사고할 수 있는 정신적 능력과 같은 진정한 문제를 다루고 있지 않다. 인간은 먼 목표를 바라볼 수 있는 선견지명이 있다. 인간은 그러한 목표에 도달하기 위해서 재료를 모으고, 조작할 수 있는 지능과 손재주가 있다. 인간은 불을 사용한다.(마이클 덴튼의 ‘Fire-Maker’를 참조하라.) 인간은 진정한 의미의 언어를 사용한다. 인간은 악기를 만들고, 예술 활동을 한다. 이것은 생존과 관련 없는 행동이다. 인간은 의미와 목적에 대한 깊은 정신적 갈망과 열정을 갖고 있다. 이러한 것들을 허용하기 위해서는, 뇌의 크기, 모양, 식단 이상의 것들이 필요하다. 사람은 하나님의 형상을 따라 만들어졌기 때문이다.



*관련기사 : 인간 뇌 진화, "작고 빠른 먹이 사냥하기 위해?" (2021. 3. 16. 데일리포스트)

https://www.thedailypost.kr/news/articleView.html?idxno=80048

인간 뇌 용적 2배 커진 이유 찾았다…거대 동물 멸종과 밀접 관계 (2021. 3. 3. 나우뉴스)

https://nownews.seoul.co.kr/news/newsView.php?id=20210303601013

침팬지와 인간의 뇌 차이, 이틀이 갈라놓았다 (2021. 4. 5. 주간조선)

http://m.weekly.chosun.com/client/news/viw.asp?ctcd=C08&nNewsNumb=002652100015

“인간의 뇌는 사회성보다는 먹고살려다 보니 커졌다” (2018. 5. 24. 한겨레)

https://www.hani.co.kr/arti/science/science_general/846015.html

침팬지보다 인간의 뇌가 3배 더 큰 이유는?  (2018. 6. 10. 동아사이언스)

http://dongascience.donga.com/news.php?idx=22738


*참조 : 뇌의 성능은 크기가 아니라, 질에 달려있다. 

http://creation.kr/Apes/?idx=1852068&bmode=view

작아지는 뇌가 인간 진화를 입증한다?

http://creation.kr/Apes/?idx=1852129&bmode=view

사람의 머리는 작아지고 있다. 

http://creation.kr/Apes/?idx=1851965&bmode=view

인류의 조상들은 큰 뇌를 가지고 태어났다 : 호모 에렉투스는 우리보다 큰 뇌를 갖고 있었다.

http://creation.kr/Apes/?idx=1852054&bmode=view

사람과 침팬지의 뇌는 완전히 달랐다. 

http://creation.kr/Apes/?idx=1852141&bmode=view

뇌 크기 : 진화론적 가정의 또 하나의 실패

http://creation.kr/Apes/?idx=1852149&bmode=view

과거 조상들은 오늘날의 육상 선수보다 빨랐다고 인류학자는 말한다. 

http://creation.kr/Apes/?idx=1852064&bmode=view

까마귀와 앵무새가 똑똑한 이유가 밝혀졌다! : 새들은 2배 이상의 조밀한 뉴런의 뇌를 가지고 있다. 

http://creation.kr/animals/?idx=1291199&bmode=view


당신의 뇌는 인터넷보다 더 많은 메모리를 가지고 있다.

http://creation.kr/Human/?idx=1291537&bmode=view

IBM은 '뇌'와 같은 컴퓨터를 제조하려고 한다.

http://creation.kr/Human/?idx=1291516&bmode=view

뇌의 능력에 근접한 세계에서 가장 빠른 컴퓨터.

http://creation.kr/Human/?idx=1291496&bmode=view

대뇌반구 절제술로부터의 회복 : 고도의 설계에 대한 증거 

http://creation.kr/Human/?idx=1291495&bmode=view

뇌의 복잡성은 상상을 초월한다. 

http://creation.kr/Human/?idx=1291514&bmode=view

성숙 뇌는 새로운 신경세포를 구축할 수 있다. 

http://creation.kr/Human/?idx=1291531&bmode=view

특별한 뇌세포는 나침반처럼 작동한다.

http://creation.kr/Human/?idx=3419268&bmode=view

뇌는 안구운동을 보정한다

http://creation.kr/Human/?idx=1291486&bmode=view

수면 중 뇌의 목욕 : 현명한 디자인 솔루션

http://creation.kr/Human/?idx=1291530&bmode=view

뇌의 긴급 브레이크

http://creation.kr/Human/?idx=1291497&bmode=view

하품은 그 목적이 있었다.

http://creation.kr/Human/?idx=1291498&bmode=view

사람과 동물의 뇌 : 유일성과 유사성 

http://creation.kr/Human/?idx=1291528&bmode=view

사람과 침팬지의 뇌는 완전히 달랐다.

http://creation.kr/Apes/?idx=1852141&bmode=view


출처 : CEH, 2021. 3. 30. 

주소 : https://crev.info/2021/03/brain-evolution-dunce/

번역 : 미디어위원회






미디어위원회
2021-04-14

데니소바인은 현대인이었다.

(Denisovans Were Modern People)

by Jerry Bergman, PhD


      새로운 연구는 미스터리한 데니소바인(호빗인)이 현대인이었다는 더 많은 증거를 제공한다.


들어가며

데니소바인(Denisovans)은 일반적으로 진화론자들에 의해서 네안데르탈인과 친척인 "호모 사피엔스(H. sapiens)의 오래된 아종"으로 간주되고 있다. 2008년에 데니소바 동굴(Denisova Cave)에서 처음 확인되었는데, 18세기에 그곳에 살았던 러시아의 은둔자인 데니스(Denis, Dyonisiy)의 이름을 딴 동굴이다.[1] 이 동굴은 카자흐스탄, 중국, 몽골과 접한 시베리아 중남부에 위치해 있다. 애들레이드 대학(University of Adelaide)의 주앙 테이셰이라(João C. Teixeira) 교수에 따르면, 우리가 갖고 있는 데니소바인에 대한 증거는 매우 제한적이라는 것이다 :

유럽에서 광범위한 화석기록을 갖고 있는 우리의 다른 사촌 네안데르탈인(Neanderthals)과는 대조적으로, 데니소바인은 거의 전적으로 DNA 기록으로만 알려져 있다. 데니소바인이 존재했다는 유일한 물리적 증거는 시베리아 동굴에서 발견된 손가락 뼈와 다른 조각들, 그리고 최근 티베트 고원에서 발견된 턱 조각의 일부뿐이었다.[2]

.데니소바인에서 나온 부분적인 턱뼈. <From Wikimedia Commons>


데니소바인 DNA에 관한 최신 연구

테이셰이라 등은 새로운 연구 결과를 Nature Ecology & Evolution 지(2021. 3. 22)에 발표했다. 이들은 동남아시아 섬들의 호미닌(hominin) 화석기록을 포함하여, 이 작은 뼛조각들의 DNA를 분석하고 다음과 같은 결론을 내렸다 :

동남아시아 섬(Island Southeast Asia, ISEA)의 현대 인류는 데니소바인과 이종 교배를 했다는 뚜렷한 유전적 흔적을 지니고 있다. 데니소바인에 대한 화석기록은 동남아시아 섬에서는 현재 결여되어 있다. 이러한 화석 증거와 유전적 증거 사이의 명백한 차이를 질문하기 위해, 우리는 동남아시아 섬의 사람 200명 이상을 포함하여, 400명 이상의 현대 인류의 유전체(genomes)에 대한 고대의 유전자침투(introgression)에 대한 포괄적인 검색을 수행했다. 우리의 결과는 동남아시아 섬들 모집단에 널리 퍼져 있는 데니소바인 조상을 확증하고 있다. 하지만 동남아시아 섬들 고유의 화석기록과 조화되는 실질적인 초-고대 혼합 신호를 감지하는 데에는 실패했다.[3]

연구팀은 데니소바인 화석이 발견된 지역에서 높은 수준의 데니소바인 조상을 보여주는 이전의 결과들을 확인할 수 있었다.[4] "데니소바인과 고대 이종교배 사건의 뚜렷한 유전적 흔적"의 발견은 그들이 현생인류와 한 종이었다는 증거이다. 다른 유전자 분석에서도 비슷한 결과가 나왔다.[5]

.데니소바인에서 나온 어금니 중 하나.<From Wikimedia Commons>


2012년 Science 지의 논문에서 마이어(Meyer) 등은 현생인류와 비교되는 새로운 유전자가 데니소바인에서는 검출되지 않았다고 했었다. 총 34개의 새로운 유전자 변이(variants)가 발견되었는데, 이 유전자 변이는 질병을 일으키는 것으로 알려진 영역에서, 단백질 아미노산 서열이 현생인류의 단백질 서열과 1-2개만 다르다.[6] 이것은 데니소바인과 사람이 둘 다 같은 창조된 종류(kind)에 속한다는 입장을 뒷받침한다.


유전자의 차이는 모두 염기치환(base substitutions)으로 인한 질병과 관련이 있다. 구체적으로, 이러한 유전자들은 자폐증(autism)과 언어장애(genes ADSL and CNTNAP2)와 관련이 있다. 유전자 EVC2는 엘리스-반 크레벨드 증후군(Ellis-Van Creveld syndrome, 연골외배엽 이형성증)과 타우로돈티즘(Taurodontism, 우상치)을 유발하여, 치아와 치수강이 커져서 치근이 짧아지는 장애를 일으킨다.

이 유전자들은 해로운 돌연변이를 갖고 있어서, 지금은 멸종된 데니소바인에서 병을 야기시켰을 가능성이 있다.


고생물학적 문제점들

데니소바인에 대한 판단은 주로 유전적 증거에 기초하고 있다. 고려해야 할 문제는 연구자들이 아주 오래된 화석에서 유전자 분석이 잘 될 수 있겠는가 라는 것이다.[7] 유전자 비교의 일반적인 문제점으로는, 오염(모든 유전자 비교 실험은 5레벨의 클린룸에서 수행되어야 하기 때문에), PCR 유도 돌연변이, 데이터 편견 등이 있다. 데니소바인의 유전적 다양성은 네안데르탈인의 7배에 달할 정도로 꽤 크다.[8] 이것은 미토콘드리아 DNA에 기초하여, 그들을 네안데르탈인의 오래된 아종으로 분류하는 것이 불확실할 수 있음을 가리킨다.

.데니소바인의 손가락 조각. <From Wikimedia ommons>


또 다른 우려는 고생물학에서 흔히 볼 수 있는 어려움에서 비롯된다. 즉, 이 경우에서 손가락 조각, 턱 조각, 어금니 세 개(그림 참조)의 사소한 증거로부터 판단을 내리는 것이다. 이 작은 조각들이 동굴에 살았던 러시아인 은둔자나, 알려지지 않았던 다른 거주자의 것이 아니라는 확고한 증거가 있는가? 또 다른 문제는 발견된 조각들이 적어도 두 명의 다른 개체들(사춘기 여성과 성인 남성)로부터 발견되었다는 것이다.[9] 이러한 우려와는 별도로, 데니소바인과 인간 둘 다 동일한 종류의 창조물에 속한다는 증거는 유효해 보인다.


네안데르탈인과 인간은 같은 창조된 종류에 속했다.

관찰자들은 데니소바인이 네안데르탈인의 한 종이라는 주장을 의심해야 한다. 거의 150년 동안 네안데르탈인은 현대 인간과 유인원 같은 조상들 사이의 진화적 연결고리로 여겨져왔다는 것을 기억하라. 네안데르탈인이 열등한 인종이 아닌, 완전히 현대 인류로 확인된 것은 최근의 일이다. 마찬가지로, 데니소바인은 한때 주장했던 것처럼 오래된 네안데르탈인의 아종이 아니라, 완전히 현대 인간인 것으로 보인다. 또한 테이셰이라 등은 데니소바인 외에 적어도 두 종의 토착종인 호모 루조넨시스(Homo luzonensis)와 호모 플로레시엔시스(Homo floresiensis)가 이 지역에 살았던 해부학적으로 현대 인류와 동일한 시기에 살았다고 결론지었다.[10] Live Science 지에 따르면, 사실 호모 플로레시엔시스(또는 "호빗(Hobbits)")는 데니소바인의 남부 분파일 수 있다. 이것은 이 모든 화석들이 단지 인류의 내부 집단이었다는 추가적인 증거인 것이다.

.교과서는 오랫동안 인간의 진화를 증명하기 위해서 왜곡된 이미지를 포함했는데, 사용된 증거들은 추후에 그렇지 않음이 밝혀졌다. 예를 들어, 네안데르탈인은 더 이상 "잃어버린 고리"로 간주되지 않고, 호모 사피엔스 내의 한 집단으로 간주되고 있다.


인간의 인지 능력을 가졌다는 증거들

위에서 언급한 단편적인 화석 증거만을 근거로, 데니소바인 인지 능력이나, 심지어 그들의 인구 동태에 대한 것도 주장됐었다. 수집한 몇 개의 화석 조각으로부터 이러한 결론을 도출하는 것은 분명 성급한 시기상조의 주장이다. 하지만, 데니소바 동굴에서 발견된 인공 유물들은 그들이 호모 사피엔스 내의 한 그룹이었다는 믿음을 뒷받침하고 있다. 발견된 유물로는 뼈로 만든 장식품, 매머드 엄니, 타조알, 연체동물의 껍질, 동물의 이빨로 만든 펜던트, 암녹색 광물(chloritolite)을 연마한 팔찌 조각 등이 있다.[11] 또한 동굴에서 바늘과 송곳을 포함한 도구들도 발견되었다. 만약 이 유물들이 사실 데니소바인에 의해 만들어진 것이라면, 그것은 그들이 현대인이었음을 뒷받침한다.


요약

증거들은 데니소바인이 네안데르탈인과 친척인 또 다른 집단이었다는 것을 보여준다. 네안데르탈인은 현생인류와 교배를 하고 있던 현대 인간이었다. 이러한 결론을 확증하기 위한 더 많은 연구가 필요하다.

.인간 진화를 증명하려고 네안데르탈인을 사용하고 있는 또 다른 편향된 교과서의 이미지.


References

[1] Gibbons, A. 2011. Who were the Denisovans? Science 333(6046):1084–1087, August 26.

[2] Quoted in Kelly Brown. 2021. The University of Adelaide NEWSROOM.  New Evidence in Search for the Mysterious Denisovans, March 23. https://www.adelaide.edu.au/newsroom/news/list/2021/03/23/new-evidence-in-search-for-the-mysterious-denisovans

[3] Teixeira, João C., et al. 2021. Widespread Denisovan ancestry in Island Southeast Asia but no evidence of substantial super-archaic hominin admixture. Nature Ecology & Evolution, March 22. https://www.nature.com/articles/s41559-021-01408-0.

[4] Teixeira, 2021.

[5] Gokhman, D., Lavi, E., Prüfer, K. et al. 2014, Reconstructing the DNA methylation maps of the Neandertal and the Denisovan. Science 344(6183):523–527, May 2. | doi: 10.1126/science.1250368.

[6] Meyer, M., Kircher, M., Gansauge, M.T. et al. 2012. A high-coverage genome sequence from an archaic Denisovan individual. Science 338(6104):222–226, October 12. | doi: 10.1126/science.1224344.

[7] Criswell, D. 2009. Neandertal DNA and modern humans. Creation Research Society Quarterly 45(4):246–254, 2009.

[8] Meyer, M.; Fu, Q.; Aximu-Petri, A., et al. 2014. A mitochondrial genome sequence of a hominin from Sima de los Huesos. Nature 505(7483):403–406, December 4. | doi:10.1038/nature12788.

[9] Reich, D.; Green, R. E.; Kircher, M., et al. 2010. Genetic history of an archaic hominin group from Denisova Cave in Siberia.  Nature 468(7327):1053–1060, December 22.

[10] Teixeira, 2021.

[11] Derevianko, A.P.; Shunkov, M.P., and Volkov, P.V. 2008. A Paleolithic bracelet from Denisova cave. Archaeology, Ethnology, & Anthropology of Eurasia 34(2):13–25, June.  | doi:10.1016/j.aeae.2008.07.002.

*Dr. Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology for over 40 years at several colleges and universities including Bowling Green State University, Medical College of Ohio where he was a research associate in experimental pathology, and The University of Toledo. He is a graduate of the Medical College of Ohio, Wayne State University in Detroit, the University of Toledo, and Bowling Green State University. He has over 1,300 publications in 12 languages and 40 books and monographs. His books and textbooks that include chapters that he authored are in over 1,500 college libraries in 27 countries. So far over 80,000 copies of the 40 books and monographs that he has authored or co-authored are in print. For more articles by Dr Bergman, see his Author Profile.


*관련기사 : 5만년 전 사라진 데니소바인, 남미인 입술에 흔적 남겼다(2021. 2. 9. 한겨레)

http://www.hani.co.kr/arti/science/science_general/982423.html

'엄마는 네안데르탈인, 아빠는 데니소바인' 소녀 화석 발견(2018. 8. 22. 연합뉴스)

http://www.yonhapnews.co.kr/bulletin/2018/08/22/0200000000AKR20180822105700017.HTML?input=1195m


*참조 : 데니소바인은 다시... 현생인류로 보인다?

http://creation.kr/Apes/?idx=1852255&bmode=view

호빗족은 완전한 사람이었다고 연구팀은 주장한다. 

http://creation.kr/Apes/?idx=1851959&bmode=view

호빗인들은 피그미 족이었는가?

http://creation.kr/Apes/?idx=1852044&bmode=view

더 많은 과학자들이 호빗인은 완전한 사람이었다고 주장한다.

http://creation.kr/Apes/?idx=1851961&bmode=view

네안데르탈인은 결국 완전한 사람이었다 : 네안데르탈인의 폐활량은 현생인류보다 더 컸다.

http://creation.kr/Human/?idx=1757435&bmode=view

동굴 벽화를 그렸던 네안데르탈인은 완전한 현생인류였다!

http://creation.kr/Apes/?idx=1852253&bmode=view

네안데르탈인의 유전자 : 진화론자들은 그들이 너무도 틀렸음에 놀라고 있었다.

http://creation.kr/Apes/?idx=1852214&bmode=view

네안데르탈인은 시신을 매장하고, 현대인처럼 말할 수 있었다.

http://creation.kr/Apes/?idx=1852173&bmode=view

루마니아의 네안데르탈인은 현대인의 특징들을 가지고 있었다. 

http://creation.kr/Apes/?idx=1852019&bmode=view

네안데르탈인의 피리? 

http://creation.kr/Apes/?idx=1851932&bmode=view

혈거인의 식생활은 원시적이지 않았다 : 네안데르탈인은 채소와 곡식을 요리해서 먹고 있었다.

http://creation.kr/Apes/?idx=1852127&bmode=view

네안데르탈인 - 변화되고 있는 실상

http://creation.kr/Apes/?idx=1851954&bmode=view

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://www.kacr.or.kr/library/print.asp?no=6876

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

벼랑 끝에 선 인류의 ‘아프리카 기원설’ : 선호되던 인간 진화 이야기는 이제 고군분투하고 있다.

http://creation.kr/Apes/?idx=3630150&bmode=view

그리스 트라칠로스에서 발견된 570만 년 전의 완전한 사람발자국으로 붕괴되고 있는 인류 진화론

http://creation.kr/Apes/?idx=1852249&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view

드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?idx=1852224&bmode=view

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view

원숭이도 무심코 돌 도구(석기)를 만들고 있었다 : 초기 인류가 만들었다는 타제석기는 의문스럽게 되었다.

http://creation.kr/Apes/?idx=1852220&bmode=view

인류의 농업은 진화론적 시간 틀로 너무 늦게 시작됐다. 인류는 13,000년 전에 이르러서야 농업을 시작했다?

http://creation.kr/Apes/?idx=1852177&bmode=view


출처 : CEH, 2021. 4. 2.

주소 : https://crev.info/2021/04/denisovans-were-modern-people/

번역 : 미디어위원회


미디어위원회
2021-04-07

인간 진화론은 지속적으로 실패하고 있다.

(Does Recent Research Support Human Evolution?)

by Frank Sherwin, M.A.  


       ICR은 1997년 Acts & Facts 지의 글에서, 사람이 유인원 같은 조상으로부터 진화했다는 것에 대한 설득력 있는 증거가 없음을 보고했다.[1] 세월이 흘렀고, 그 이후로 인류 진화의 사례는 어떻게 발전해 왔는지 살펴보자.

그 동안의 발견들은 진화론자들을 당혹스럽게 만들고 있었다. 먼저, 진화론적 글들도 퉁명스럽게 말한다 : "지난 15년 동안 우리는 누구이고, 어디에서 왔는지에 대한 모든 가정들에 의문이 제기되어 왔다. 알고 보니, 인간의 진화는 생각했던 것보다 더 당혹스럽다."[2] 다른 기사도 인정하고 잇었다 : "화석들은 너무도 드물기 때문에, 연구자들은 살아있는 원숭이와 인간의 마지막 공통조상이 어떻게 생겼을지, 어디에서 유래했는지, 알지 못한다"[3]

ICR 유전학자 제프 톰킨스(Jeff Tomkins) 박사의 연구에 의하면, 사람과 침팬지의 유전체(genomes)는 진화론자들이 오랫동안 주장했던 것처럼 98%가 유사하지 않음을 보여주었다.[4] 가장 최근의 데이터에 의하면, 사람과 침팬지 유전체는 85%도 비슷하지 않았다.

사람과 원숭이의 침(saliva)을 비교한 연구도 진화적 연관성을 발견하지 못했다. 세속적 논문에 따르면, "우리는 사람의 침에서 비-인간 영장류의 침과 구별되는 독특한 단백질을 발견했다."[5]

향상진화(anagenesis)는 "종분화(speciation)"을 의미하는 진화적 용어로서, 수많은 생물 종이 하나의 계통을 따라 진화했던 과정을 의미한다. 1996년(그리고 훨씬 이전)부터 인간 진화론의 "조상-후손 계열"은 부모나 조부모보다 아이가 먼저 존재하는 문제로 골머리를 앓고 있다. 유인원 같은 생물에서 인간으로 진화했다는 주장은 심각하게 잘못된 연대(out-of-place)의 화석들에 의해서 끊임없이 도전받아왔으며, 도전받고 있다. 예를 들어 오스트랄로피테쿠스의 두 종과 같은 예들이 그러한 것이다 :

우리는 또한 오스트랄로피테쿠스 아나멘시스(Australopithecus anamensis)와 오스트랄로피테쿠스 아파렌시스(Australopithecus afarensis)가 이전에 알고 있었던 것보다 더 많이 다르며, 이 두 종이 적어도 10만 년 동안 겹쳐서 같이 살고 있었다는 것이 입증되었다. 가장 중요한 것은, 널리 받아들여지고 있는 향상진화 가설과는 상반되게, 오스트랄로피테쿠스 아파렌시스는 계통발생(진화)의 변형 결과로 나타나지 않았음을 MRD[새로 발견된 두개골]는 보여준다.[6]

2015년에 진화론자들은 호모 날레디(Homo naledi)라는 이름의 화석을 소개했는데, 이 화석은 즉시로 인간의 조상으로 받아들여졌다. 300만 년 전이라는 연대에 편안함을 느끼며, "버거 교수는 날레디가 더 원시적인 이족보행 영장류와 인간 사이의 '다리'로 생각될 수 있다고 말했다."[7] 그러나 아뿔싸, 호모 날레디는 이전에 생각했던 것보다 훨씬 더 젊은 연대로 드러났다. 그것은 해부학적으로 현생인류와 겹치면서 살고 있었다.[8]

그리고 나쁜 소식이 더 있다. 2002년 사헬란트로푸스 차덴시스(Sahelanthropus tchadensis)가 발견되어 초기 인간의 친척으로 선언되었지만, 그것은 "호미닌(hominin)이 전혀 아니었을 수도 있으며, 오히려 침팬지와 같은 다른 원숭이들과 더 밀접하게 연관되어 있었다."[9]

우리가 더 최근의 인간 조상들에게 눈을 돌리면, 그들이 100% 사람들이라는 것을 알 수 있다. 세속적 과학자인 마이클 덴튼(Michael Denton)은 다음과 같이 말했다 :

네안데르탈인과 데니소바인은 호모 사피엔스의 아종이나 종족으로 분류되어야 하며, 이것은 그들이 언어를 사용했으며, 상대적으로 높은 지능을 갖고 있었다는 것을 가리킨다.[10]

언어를 사용했으며 상대적으로 높은 지능? 당신 이웃의 대부분이 이러한 설명에 적합할 것이다.

진화론적 자연주의자들은 조각난 화석 뼈들로부터 침팬지와 사람을 연결시키려는 헛된 노력을 계속 기울여왔다. 그럼에도 불구하고, 성경의 메시지는 분명하다. 사람은 처음부터 하나님의 형상을 따라 창조되었다는 것이다.


References

1. Sherwin, F. 1997. “Human Evolution” An Update. Acts & Facts. 26 (9).

2. Barras, C. Who are you? How the story of human origins is being rewritten. New Scientist. Posted on newscientist.com August 23, 2017, accessed February 5, 2021.

3. New Study Suggests That Last Common Ancestor of Humans and Apes Was Smaller than Thought. American Museum of Natural History press release. Posted on amnh.org October 12, 2017.

4. Tomkins, J. P. 3-D Human Genome Radically Different from Chimp. Creation Science Update. Posted on ICR.org January 7, 2021, accessed February 5, 2021; Tomkins, J. P. 2018. Separate Studies Converge on Human-Chimp DNA Dissimilarity. Acts & Facts. 47 (11): 9.

5. Thamadilok, S. et al. 2019. Human and Non-Human Primate Lineage-Specific Footprints in the Salivary Proteome. Molecular Biology and Evolution. 37 (2): 395-405; Tomkins, J. P. Ape Spit Radically Different from Human. Creation Science Update. Posted on ICR.org November 12, 2019, accessed February 11, 2021.

6. Haile-Selassie, Y. et al. 2019. A 3.8-million-year-old hominin cranium from Woranso-Mille, Ethiopia. Nature. 573: 214-219.

7. Ghosh, P. New human-like species discovered in S Africa. BBC News. Posted on bbc.com September 10, 2015, accessed February 12, 2021.

8. Rincon, P. Primitive human ‘lived much more recently.’ BBC News. Posted on bbc.com April 25, 2017, accessed February 12, 2021.

9. Marshall, M. Our supposed earliest human relative may have walked on four legs. New Scientist. Posted on newscientist.com November 18, 2020, accessed February 12, 2021. Tomkins, J. P. Sahelanthropus Femur Likely Makes It a Chimp. Creation Science Update. Posted on ICR.org December 10, 2020, accessed February 11, 2021.

10. Denton, M. 2016. Evolution: Still a Theory in Crisis. Seattle, WA: Discovery Institute Press, 198.

* Mr. Sherwin is Research Associate at the Institute for Creation Research and earned his M.A. in zoology from the University of Northern Colorado.

Cite this article: Frank Sherwin, M.A. 2021. Does Recent Research Support Human Evolution?. Acts & Facts. 50 (4).


*참조 : 35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://creation.kr/Apes/?idx=1852263&bmode=view

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

벼랑 끝에 선 인류의 ‘아프리카 기원설’ : 선호되던 인간 진화 이야기는 이제 고군분투하고 있다.

http://creation.kr/Apes/?idx=3630150&bmode=view

그리스 트라칠로스에서 발견된 570만 년 전의 완전한 사람발자국으로 붕괴되고 있는 인류 진화론

http://creation.kr/Apes/?idx=1852249&bmode=view

라에톨리 발자국은 진화론과 조화되지 않는다 : 366만 년(?) 전의 발자국은 현대인의 것과 유사했다.

http://creation.kr/Apes/?idx=1852118&bmode=view

라에톨리에서 새로운 사람 발자국들의 발견

http://creation.kr/Apes/?idx=2273260&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view

드마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?idx=1852224&bmode=view

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view

원숭이도 무심코 돌 도구(석기)를 만들고 있었다 : 초기 인류가 만들었다는 타제석기는 의문스럽게 되었다.

http://creation.kr/Apes/?idx=1852220&bmode=view

인류의 농업은 진화론적 시간 틀로 너무 늦게 시작됐다. 인류는 13,000년 전에 이르러서야 농업을 시작했다?

http://creation.kr/Apes/?idx=1852177&bmode=view

농업의 기원은 진화론적 장구한 연대를 부정한다. : 30만 년 전에 출현한 현대 인류가 1만 년 전에 농업을 시작?

http://creation.kr/BiblicalChronology/?idx=1289295&bmode=view

네안데르탈인은 결국 완전한 사람이었다 : 네안데르탈인의 폐활량은 현생인류보다 더 컸다.

http://creation.kr/Human/?idx=1757435&bmode=view

동굴 벽화를 그렸던 네안데르탈인은 완전한 현생인류였다!

http://creation.kr/Apes/?idx=1852253&bmode=view

네안데르탈인의 유전자 : 진화론자들은 그들이 너무도 틀렸음에 놀라고 있었다.

http://creation.kr/Apes/?idx=1852214&bmode=view

네안데르탈인은 시신을 매장하고, 현대인처럼 말할 수 있었다.

http://creation.kr/Apes/?idx=1852173&bmode=view

루마니아의 네안데르탈인은 현대인의 특징들을 가지고 있었다. 

http://creation.kr/Apes/?idx=1852019&bmode=view

네안데르탈인의 피리? 

http://creation.kr/Apes/?idx=1851932&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다? 

http://creation.kr/Apes/?idx=1852218&bmode=view

호모 하빌리스와 호모 에렉투스는 동시대를 살았다. 

http://creation.kr/Apes/?idx=1852015&bmode=view

원숭이도 무심코 돌 도구(석기)를 만들고 있었다 : 초기 인류가 만들었다는 타제석기는 의문스럽게 되었다.

http://creation.kr/Apes/?idx=1852220&bmode=view

330만 년 전으로 주장되는 돌 도구(석기)의 발견으로, 교과서의 인간 진화론은 또 다시 수정되어야만 한다. 

http://creation.kr/Apes/?idx=1852243&bmode=view

50만 년 전(?) 인류는 돌칼을 만들고 장애아를 돌보았다.

http://creation.kr/Apes/?idx=1852074&bmode=view

‘석기시대’ 사람들은 놀랍도록 현대적이었다. : 배를 만들고, 장신구와 화장을 하고, 곡물을 먹고, 구분된 공간을 가졌다.

http://creation.kr/Apes/?idx=1852106&bmode=view

초기 인류는 원시적이지 않았다 : 인도에서 7만5천 년(?) 전의 돌연장과 남아프리카에서 7만 년(?) 전의 알껍질 장식의 발견

http://creation.kr/Apes/?idx=1852108&bmode=view

인류의 조상들은 배를 타고 항해를 할 수 있었다 : 지중해 크레타 섬에서 석기시대(13만 년 전)의 돌연장들이 발견되었다.

http://creation.kr/Apes/?idx=1852101&bmode=view

고대 인류의 유물이 섬에서 발견되었다 : 초기 인류는 배를 타고 항해를 했다.

http://creation.kr/Apes/?idx=2613754&bmode=view

50만 년 전(?) 조개에 기하학적 무늬가 새겨져 있었다! : 호모 에렉투스는 생각했던 것보다 현명했다?

http://creation.kr/Apes/?idx=1852180&bmode=view

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view

독일의 30만 년(?) 전 인류의 거주 장소에서 창, 불의 사용, 난로, 말뼈, 신선한 나무...등이 발견되었다.

http://creation.kr/Apes/?idx=1852191&bmode=view

30만 년 전 독일 석탄 광산에서 발견된 8자루의 창

http://creation.kr/Apes/?idx=1852139&bmode=view

130만 년 전(?) 초기 인류는 자원 재활용을 하고 177만 년 전(?) 호모 에렉투스는 이쑤시개를 사용했다. 그리고 음악과 언어에 대한 진화론자들의 공상

http://creation.kr/Apes/?idx=1852169&bmode=view

사람의 불 사용은 알려진 것보다 더 오래됐다. : 70만~100만 년 전에 인류는 불을 사용했다?

http://creation.kr/Apes/?idx=1852161&bmode=view


출처 : ICR, 2021. 3. 31.

주소 : https://www.icr.org/article/does-recent-research-support-human-evolution/

번역 : 미디어위원회


미디어위원회
2021-01-18

인도네시아에서 발견된 4만5500년 전의 동굴 벽화 

(Cave Art Dates Contradict Human Nature)

David F. Coppedge


    동굴에 돼지 벽화를 그렸던 예술가들은 기록된 역사의 5배의 기간 동안 무엇을 했을까?

언론 매체들은 모두 아프리카나 유럽이 아닌, 인도네시아의 섬에서 가장 오래된 동물 그림이 발견되었다고 주장했다. 보르네오(Borneo) 해안의 술라웨시(Sulawesi) 섬에 있는 접근하기 어려운 석회암 동굴에서, 고고학자들은 야생 염소, 돼지, 손자국 그림을 발견했다. 연구자들은 일부 그림은 적어도 40,000년이 되었다고 주장하고 있었다.(30,000년에서 33,000년 전으로 알려진 유명한 쇼베 동굴(Chauvet cave) 그림보다 오래되었다). 가장 오래된 “털이 많은 돼지” 그림은 45,500년이 되었다는 것이다. 그림 사진을 보려면  Live Science 지나, 동굴 내부의 비디오 영상물과 해설을 보려면 BBC News(2021. 1. 13)를 클릭하여 살펴보라. 진화론자들은 그림의 ‘출현(emergence)’을 진화하는 지능(evolving intelligence)의 한 신호로 해석하고 있었다. 기자는 이렇게 말한다.

이제 과학자들은 우리 인간 종이 진정한 인간이 된 중요한 순간인, 최초의 예술 활동이 언제, 그리고 결정적으로 어디에서 출현했는지를 다시 생각해야만 할 것이다. 

.박물관에 있는 동굴 원시인에 대한 진화론적 그림.


이 연구는 Science Magazine(2021. 1. 13)에 게재되었다. 아담 브룸(Adam Brumm)은 말한다. “레앙 테동게(Leang Tedongnge)의 동물 그림은 지금까지 알려진 세계에서 가장 오래된 대표적인 예술 작품이다.” 연대는 그림 위로 성장한 방해석(calcite) 결정의 우라늄-토륨 연대측정(uranium-thorium dating)으로부터 추정되었다. 그러나 Live Science 지는 조심하고 있었다 :

그러나 우라늄-토륨 연대측정에 많은 기술적 어려움이 있기 때문에, 연구자들은 그 연대를 대략적으로 추정했다고, 연구에 참여하지 않은 남아프리카의 비트바테르스란트(Witwatersrand) 대학의 암벽화 연구소(Rock Art Research Institute) 부교수인 데이비드 피어스(David Pearce)는 말했다. 그는 Live Science 지에 이메일을 통해 썼다. "그 연대는 그림 자체의 직접적 연대라기보다는... 상대적 연대라는 것을 기억하는 것이 중요하다."

.프랑스 쇼베 동굴(Chauvet Cave)의 동물 그림. 현대 미술의 아버지로 말해지는 폴 세잔(Paul Cezanne)의 그림에 필적한다. 3만5000년 전으로 평가되는 이 동굴 벽화에는 코뿔소, 동굴 사자, 무소, 말, 들고양이 등이 그려져 있다.


Science 지의 논문은 이 발견이 인류의 진화 이야기에서 어디에 적합한지 나타내기 위해서 연대표를 제시하고 있었다 :

오늘날 화석 증거에 근거하여, 현생인류는 아프리카에서 30만 년 전에 출현했다고 주장된다. 더욱이 일부 고고학적 데이터와 유전체 데이터는 호모 사피엔스(H. sapiens)가 12만 년 전에 동아시아에서 살았음을 암시한다. AMH(anatomically modern humans, 해부학적으로 현대인)은 거의 같은 시기에 최북단 순다(Sunda, 인도네시아)에도 있었다. 현재 이용 가능한 증거에 근거하여, 우리는 (45,500년 전의) 이 레앙 테동게의 동굴 그림이 인지적으로 "현대적" 인류의 작품이라고 확정적으로 결론내릴 수는 없지만, 초기 예술 작품의 정교함과 비유적 묘사가 지금까지 세계의 다른 곳에서 AMH에 기인했다는 사실을 고려해볼 때, 가능성이 높은 것으로 보인다.

이제 인도네시아의 한 섬에서 발견된 뛰어난 동굴 그림은 진화론자들의 인간 진화 이야기를 변경시키고 있고, 다시 한 번 복잡한 지적 능력이 그들이 “생각했던 것보다 일찍” 출현하고 있음을 보여주고 있었다. 

-------------------------------------------------


그들의 연대는 아무런 의미가 없다. 논문에서 제시한 사실들만 생각해보라.

▶ 오늘날에도 그 동굴 근처에는 같은 종류의 돼지가 살고 있다.

▶ 새로운 이야기는 오래된 인류 진화의 '아웃 오브 아프리카(out of Africa)' 이야기와 모순된다. 왜냐하면 예술가들은 아프리카에서 멀리 떨어진 이곳 인도네시아의 섬에 그 이전부터 살고 있었다.

▶ 그러한 연대가 사실이라면, 45,500년(455세기) 동안 그 섬에는 수많은 사람들이 살아왔었을 것인데, 왜 소수만이 동굴에 그림을 그렸고, 그들이 살았던 흔적들은 모두 어디에 있는가?

▶ 유럽에도 이와 비슷한 예술 수준의 그림은 해부학적 완전히 현대인에 의해서 만들어졌다고 주장되어왔다. 그렇다면 이제 지구 반대편에서도 해부학적 완전히 현대인이 살았다는 것이 아닌가? 

▶ 과학자들은 동굴 벽에서 고대인의 DNA와 침(saliva)을 찾을 수 있을 것이라고 생각하고 있었다. 그 물질은 빠르게 분해된다.

그러므로 우리가 지금까지 수십 년 동안 들어왔던 인간 진화 이야기는 거짓이었다. 그동안 National Geographic 지에 게재됐던 인간 진화에 대한 모든 기사들은 잘못된 것이었다. 전 세계의 동굴 벽화들은 고대인들이 지적이었고, 창의적인 사람들이었음을 증거하고 있다.

"그것은 최초의 현생인류에 의한 동굴 그림이 오랫동안 생각해왔던 것처럼 빙하기 유럽에서 발생하지 않았다는 증거에 또 하나가 추가되는 것이다. 그러한 예술 활동은 인간 여정의 초기 시점부터 있었다." 아담 브룸은 말한다.

그들의 말에서 가장 불합리한 것은 우리처럼 모든 재능과 지적능력을 가졌던 사람들이 수만 년 동안 아무것도 발명하지 않고 원시적인 삶을 살아왔다는 것이다. 그보다 훨씬 짧은 시간 만에 인류는 진흙집에서 살다가 우주탐사선을 만들고 입자가속기를 만들지 않았는가? 인류는 대륙들을 건너 여행을 하고, 핸드폰과 인터넷으로 대화를 한다. 이것이 우리가 알고 있는 인간의 특성이다. 우리와 동일한 사람들이 수만 년 동안 기술들을 발전시키지 못하고, 동굴에서만 살아왔다는 주장이 합리적일 수 있을까?

브룸은 말했다. "나는 말문이 막혀버렸다". "그것은 전 세계에서 알려진 것 중에 가장 훌륭하고 잘 보존된 동물 그림 중 하나이며, 나는 즉시 넋이 나가 버렸다."

그는 놀라서 말이 나오지 않았다는 것이다. 이해가 된다. 그는 진화생물학 수업을 들었고, 다와인(Darwine)을 마셨고, 수염난 다윈에게 그의 뇌를 제물로 바친 후, 어리석고 멍청한 상태가 되었다. 과학자들이 이러한 오랜 연대를 믿는 이유는 진화론이 오랜 시간을 필요로 하기 때문이다. 

진화론이라는 ‘위대한 신화(Grand Myth)’ 내로 지질학, 생물학, 유전학, 생태학, 천문학, 인류학 등은 복속되었다. 세속적 과학자들은 현대의 바알인 진화론과 장구한 연대는 무릎을 꿇었다. 수억 수천만 년이라는 연대는 절대 변경할 수 없는 "신성한 법률"로 선포되었다. 학생들은 어려서부터 이 ‘위대한 신화’로 세뇌되고, 이 신화는 ‘종교’가 아니라 ‘과학’이라고 배운 다음, 성장한 후에 이러한 사고에 반대하는 자들에 대해 조롱과 비난을 퍼붓는다. 그들은 자신들의 신화도 일종의 종교라는 생각을 하지 못하고, 자신들을 지성적인 사람들이라고 생각한다. 45,500년 전에 동굴 벽에 돼지를 그렸던 사람들이, 수만 년 동안 문명을 이루지 못하고, 동굴에서만 살았다는 것이다. 와우! 그들의 술취한 과학은 멋지지 않은가!

유럽에서 발견된 동굴벽화와 마찬가지로, 이러한 그림과 묘사를 할 수 있었던 사람들이 45,500년 동안 아무 것도 하지 않았다는 생각은 정말로 멍청한 생각이다. 다윈의 우물 밖으로 나와 오랜 연대라는 안경을 벗고, 증거들을 숙고해 보라. 두뇌를 가진 인간은 창의적이고, 안주하지 않고, 무언가를 발명하지 않는가? 그들은 4만 년은 말할 것도 없고, 1천 년도 동굴에서만 살지 않았을 것이다. 그러한 오랜 연대 동안 인구 수는 얼마로 늘어났겠는가?(참조 : 인구성장률이 가리키는 인류의 역사는?) 그들이 모두 동굴에서만 살았는가? 아니 살아갈 동굴도 부족했을 것이다. 누추하고 컴컴한 다윈의 극장에서 나와, 건너편의 햇빛이 비치는 창조 공원으로 나가 맑은 공기를 마시며, 산책을 해보라. 진화론자들이여 제발 상식적으로 생각해 보라. 진화론이라는 위대한 신화는 정말로 우스꽝스러워 보인다.

성경적 창조론자들은 이제 자신감을 가져도 될 것이다. 이제 진화론과 장구한 연대가 허구라는 증거들이 산처럼 쌓여가고 있다. 모든 세속적 과학 저널과 언론 매체들이 일방적으로 보도하고 있는 그들의 어리석은 이론은 매우 불합리함이 드러나고 있다. 크리스천들은 이러한 보도를 듣게 된다면, 한 번 크게 웃어주라.


*관련기사 1 : 현생인류가 그린 가장 오래된 돼지 벽화 발견 (2021. 1. 14. 한겨레)

http://www.hani.co.kr/arti/science/science_general/978694.html

4만5000년 전 멧돼지…印尼서 가장 오래된 동굴 벽화 발견 (2021. 1. 14. 동아일보)

https://www.donga.com/news/article/all/20210114/104925919/1

4만5500년전 멧돼지 동굴벽화 인니서 발견…세계 최고 (2021. 1. 15. 뉴스1)

https://www.news1.kr/articles/?4181038

인류 역사상 가장 오래된 벽화 발견…4만5500년 전 돼지 그림 (2021. 1. 14. 머니투데이)

https://news.mt.co.kr/mtview.php?no=2021011407514914217

인도네시아서 세계 최고 동굴벽화 또 발견 (2021. 1. 14. 서울신문)

https://www.seoul.co.kr/news/newsView.php?id=20210114500151&wlog_tag3=naver


*관련기사 2 : 동물그림 쇼베 동굴벽화 처음 그린 건 3만7천년 전 (2016. 4. 12. 서울신문)

https://www.seoul.co.kr/news/newsView.php?id=20160412800145

1만7천 년 전 구석기인들의 숨결, '라스코 동굴벽화' 완벽 재현 (2016. 12. 15. 연합뉴스)

https://www.yna.co.kr/view/MYH20161215012800355

라스코 동굴 벽화는 운석 충돌에 관한 별자리 기록 (2018. 11. 28. 연합뉴스)

英연구팀 "4만년 전 선사시대 인류 천문지식 갖춰"

https://www.yna.co.kr/view/AKR20181128148300009

스페인에서 6만여 년 전 동굴벽화 발견 (2018. 2. 23. 연합뉴스)

11만년 전 조개 공예품도 네안데르탈인 작품

https://www.yna.co.kr/view/AKR20180223053900017

인류 최초 동굴 벽화(5만1800년 전), 아시아에서 발견 (2018. 11. 8. The Science Times)

https://www.sciencetimes.co.kr/news/%EC%9D%B8%EB%A5%98-%EC%B5%9C%EC%B4%88-%EB%8F%99%EA%B5%B4-%EB%B2%BD%ED%99%94-%EC%95%84%EC%8B%9C%EC%95%84%EC%97%90%EC%84%9C-%EB%B0%9C%EA%B2%AC/

인류 最古 동굴벽화 기록 바뀐다 (2019. 12. 12. 동아사이언스)

인도네시아 4만4000년전 벽화 발견…상상의 산물 '반인반수' 포함

http://dongascience.donga.com/news.php?idx=32917


*참조 : 아시아에서 가장 오래된 동굴벽화의 발견으로 당황하고 있는 진화 인류학자들

http://creation.kr/Human/?idx=1757437&bmode=view

고대의 페인팅 작업장은 인간의 진화이야기에 도전하고 있다. : 인간의 현대적 사고능력과 인지능력이 10만 년 전부터?

http://creation.kr/Apes/?idx=1852120&bmode=view

호주 원주민들은 언제부터 호주에 살게 되었는가?

http://creation.kr/BiblicalChronology/?idx=1289269&bmode=view

동굴 벽화를 그렸던 네안데르탈인은 완전한 현생인류였다!

http://creation.kr/Apes/?idx=1852253&bmode=view

인간의 동굴 사용 : 종유석과 석순은 장구한 연대와 모순된다.

http://creation.kr/Sediments/?idx=1288585&bmode=view

놀라운 말타의 동굴인들 : 현대인도 최근까지 동굴에서 거주하고 있었다.

http://creation.kr/archaeology/?idx=1288725&bmode=view

네안데르탈인은 결국 완전한 사람이었다 : 네안데르탈인의 폐활량은 현생인류보다 더 컸다.

http://creation.kr/Human/?idx=1757435&bmode=view

석기시대의 동굴 벽화에 언어의 흔적? 

http://creation.kr/Apes/?idx=1852159&bmode=view

12km 길이의 아마존 벽화와 홍수 후 빙하기.

http://creation.kr/Apes/?idx=5650823&bmode=view

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://creation.kr/Apes/?idx=1852263&bmode=view

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

벼랑 끝에 선 인류의 ‘아프리카 기원설’ : 선호되던 인간 진화 이야기는 이제 고군분투하고 있다.

http://creation.kr/Apes/?idx=3630150&bmode=view

인간 진화론의 또 하나의 번복 : 인류의 탄생 장소는 아프리카가 아니라, 유럽이다?

http://creation.kr/Apes/?idx=1852247&bmode=view

농업의 기원은 진화론적 장구한 연대를 부정한다. : 30만 년 전에 출현한 현대 인류가 1만 년 전에 농업을 시작?

http://creation.kr/BiblicalChronology/?idx=1289295&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view

그리스에서 570만 년 된 사람 발자국의 발견? : 트라칠로스의 발자국으로 다시 써야하는 인류 진화론

http://creation.kr/Apes/?idx=1852249&bmode=view

고대의 방직공장? : 34,000년(?) 전의 고대인들이 만든 섬유가 발견되었다.

http://creation.kr/Apes/?idx=1852060&bmode=view

인류의 열처리 기술은 7~16만 년 전부터 시작됐다?

http://creation.kr/Apes/?idx=1852089&bmode=view

고대 인류의 유물이 섬에서 발견되었다 : 초기 인류는 배를 타고 항해를 했다.

http://creation.kr/Apes/?idx=2613754&bmode=view

인류의 조상들은 배를 타고 항해를 할 수 있었다 : 지중해 크레타 섬에서 석기시대(13만 년 전)의 돌연장들이 발견되었다.

http://creation.kr/Apes/?idx=1852101&bmode=view

독일의 30만 년(?) 전 인류의 거주 장소에서 창, 불의 사용, 난로, 말뼈, 신선한 나무...등이 발견되었다.

http://creation.kr/Apes/?idx=1852191&bmode=view

30만 년 전 독일 석탄 광산에서 발견된 8자루의 창

http://creation.kr/Apes/?idx=1852139&bmode=view

50만 년 전(?) 조개에 기하학적 무늬가 새겨져 있었다! : 호모 에렉투스는 생각했던 것보다 현명했다?

http://creation.kr/Apes/?idx=1852180&bmode=view

50만 년 전(?) 인류는 돌칼을 만들고 장애아를 돌보았다.

http://creation.kr/Apes/?idx=1852074&bmode=view

‘석기시대’ 사람들은 놀랍도록 현대적이었다. : 배를 만들고, 장신구와 화장을 하고, 곡물을 먹고, 구분된 공간을 가졌다.

http://creation.kr/Apes/?idx=1852106&bmode=view

80만 년(?) 전의 인류는 세분화된 거주 공간을 가지고 있었다 : 그리고 157만 년(?) 전의 유럽인들은 연장을 만들고 있었다.

http://creation.kr/Apes/?idx=1852196&bmode=view

130만 년 전(?) 초기 인류는 자원 재활용을 하고 177만 년 전(?) 호모 에렉투스는 이쑤시개를 사용했다. 그리고 음악과 언어에 대한 진화론자들의 공상

http://creation.kr/Apes/?idx=1852169&bmode=view

사람의 불 사용은 알려진 것보다 더 오래됐다. : 70만~100만 년 전에 인류는 불을 사용했다?

http://creation.kr/Apes/?idx=1852161&bmode=view

330만 년 전으로 주장되는 돌 도구(석기)의 발견으로, 교과서의 인간 진화론은 또 다시 수정되어야만 한다. 

http://creation.kr/Apes/?idx=1852243&bmode=view

원숭이도 무심코 돌 도구(석기)를 만들고 있었다 : 초기 인류가 만들었다는 타제석기는 의문스럽게 되었다.

http://creation.kr/Apes/?idx=1852220&bmode=view


출처 : CEH, January 16, 2021.

주소 : https://crev.info/2021/01/cave-art-human-nature/

번역 : 미디어위원회

미디어위원회
2021-01-14

12km 길이의 아마존 벽화와 홍수 후 빙하기.

(Amazonian Artwork and the Post-Flood Ice Age)

by Jake Hebert, PH.D. 


      거대한 길이의 남미대륙의 빙하기 벽화는 성경적 창조론자들에게 흥미로울 수 있다. 2017년과 2018년에 과학자들은 콜롬비아 북부 열대우림에서 약 12km 길이의 빙하기 암벽화 시리즈를 발견했다.[1] 그들의 연구는 원래 2020년 4월에 발표됐지만, 2020년 11월 말에 영국에서 텔레비전 다큐멘터리가 방영되면서 추가 발표되었다.[1-3]

“벽화”는 수천 개의 붉은 황토색의 손자국 그림, 멸종된 빙하기 동물들을 포함하여 다양한 동물들, 기하학적 모양의 그림으로 구성되어 있다. 사진들과 이러한 그림에 대한 짧은 영상물은 온라인에서 볼 수 있다.[1] 이 발견은 적어도 두 가지 이유로 성경적 창조론자들에게 흥미롭다.


첫째, 이 그림은 빙하기 시대 인간의 높은 지능을 나타낸다. 예술적 표현뿐만 아니라, 이 사람들은 그림을 그린 바위 표면에 불을 사용했다는 사실에서도 알 수 있다. 그리고 그림 중 일부가 높은 곳에 있기 때문에, 미술가들은 아마도 사다리를 만들어 그림을 그렸을 것이다.[3] 빙하기 사람들이 똑똑했었다는 것은 성경적 창조론자에게는 놀라운 일이 아니다. 그들은 노아 가족의 후손들로서 바벨에서 언어의 혼잡과 분산 이후에 남아메리카로 이주했기 때문이다.[4]

둘째, 보도 자료들은 오늘날 우리가 알고 있는 울창한 숲이 빙하기 동안에는 비교적 드물었다는 것을 상기시켜준다.

그림이 그려졌을 시기에 기온은 상승하고 있었고, 이 지역은 사바나 기후에서 자라던 관목들, 갤러리 숲(gallery forests), 산지성 식물들이 있던 숲에서, 오늘날의 활엽수가 울창한 열대 아마존 숲으로 변모하기 시작했다.[3]

빙하기 동안에 얼음으로 뒤덮이지 않은 지역에서도 울창한 숲은 드물었다.[5] 대신 풀이 무성한 사바나와 툰드라와 같은 풍경이 일반적이었다. 위의 인용문에서 알 수 있듯이, 일부 과학자들은 빙하기에는 기온이 낮았기 때문에, 울창한 숲의 부족을 설명하려고 한다. 그러나 오늘날 추운 기후에서도 상록수림은 존재하고 존재할 수 있기 때문에, 이것은 설득력이 없다.

이 미스터리는 동일과정설 과학자들을 오랫동안 당혹스럽게 해왔지만, 창세기 홍수에 의해 야기된 신속하게 뒤따른 빙하기는 이것을 설명할 수 있다.[5,6] 왜냐하면 세계의 모든 숲들은 전 지구적 홍수로 파괴되었고, 자연적으로 울창한 숲의 형성에는 수백 년이 걸리기 때문이다. 노아홍수 이후에 수백 년 동안 지속됐던 빙하기 동안, 울창한 숲은 드물었을 것이 예상될 수 있다.[7] 아마도 빙하기 동안에 살았던 아브라함 시대에, 나무들이 랜드마크로 사용되었다는 사실은 그 당시 커다란 나무들이 드물었다는 하나의 단서가 될 수도 있다.[8]

몇몇 과학자들은 ‘잃어버린(missing)’ 빙하기 산림에 대해서 남미대륙은 예외일 것이라고 생각하지만, 다른 과학자들은 그 반대라고 생각한다. 남미대륙은 과거 산림의 크기와 위치를 추정하는데 사용되는 꽃가루 화석(pollen fossil) 데이터가 부족하여 결론을 내리기가 어렵다.[5,9-10] 어쨌든 위의 인용문은 남미대륙이 빙하기 동안, 비록 초원의 범위에 대한 논란은 있지만, 많은 초원과 사바나를 가졌다는 일반적인 합의를 보여준다.[11]

과학자들은 이 벽화를 그렸던 빙하기 사람들에 대해 더 많이 배울 수 있기를 바란다. 이 발견은 성경이 실제 역사를 기록한 책이며, 이 역사는 얼마 전에 일어났음을 상기시켜준다.



References

1. Geggel, L. Sprawling 8-mile-long ‘canvas’ of ice age beasts discovered hidden in Amazon rainforest. LiveScience. Posted on livescience.com December 1, 2020, accessed December 8, 2020.

2. Morcote-Ríos, G. et al. 2020. Colonisation and early peopling of the Colombian Amazon during the Late Pleistocene and the Early Holocene: New evidence from La Serranía La Lindosa. Quaternary International. Posted on sciencedirect.com April 29, 2020.

3. Newly discovered Amazon rock art show the rainforest’s earliest inhabitants living with giant Ice Age animals. University of Exeter news release. Posted on exeter.ac.uk November 30, 2020, accessed December 8, 2020.

4. Genesis 11:1-9.

5. Hebert, J. 2020. Missing Ice Age Forests Fit Flood/Ice Age Model. Acts & Facts. 49 (6): 16-19.

6. Hebert, J. 2018. The Bible Best Explains the Ice Age. Acts & Facts. 47 (11): 10-13.

7. Eng, K. F. How to Grow a Forest Really, Really Fast. TED Fellows. Posted on fellowsblog.ted.com February 18, 2015, accessed December 8, 2020.

8. E.g., Genesis 12:6.

9. Mayle, F. E. et al. 2009. Vegetation and Fire at the Last Glacial Maximum in Tropical South America. In Past Climate Variability in South America and Surrounding Regions: From the Last Glacial Maximum to the Holocene. F. Vimeux, F. Sylvestre, and M. Khodri, eds. New York: Springer, 89-112.

10. Colinvaux, P. A. 1989. Ice-age Amazon revisited. Nature. 340 (6230): 188-189.

11. Tropical rainforest thrived throughout last ice age. University of Michigan News. Posted on news.umich.edu January 5, 2007, accessed December 8, 2020.

*Dr. Jake Hebert is Research Associate at the Institute for Creation Research and earned his Ph.D. in physics from the University of Texas at Dallas.


*관련기사 : 길이만 12㎞…아마존 열대우림서 1만2000년 된 벽화 발견 (2020. 11. 30. 나우뉴스)

https://nownews.seoul.co.kr/news/newsView.php?id=20201130601004

거대 나무늘보에 사람 손바닥…'길이만 12km' 벽화 발견 (2020. 11. 30. SBS News)

https://news.sbs.co.kr/news/endPage.do?news_id=N1006098690

아마존 한가운데 폭 12km, 1.2만 년 전 거대 벽화 발견 (2020. 12. 7. YTN)

https://www.ytn.co.kr/_ln/0134_202012071740299997


*참조 : 아시아에서 가장 오래된 동굴벽화의 발견으로 당황하고 있는 진화 인류학자들

http://creation.kr/Human/?idx=1757437&bmode=view

아나사지 인디언들은 공룡과 함께 살았는가? : 암벽에 그려져 있는 브론토사우르스

http://creation.kr/Dinosaur/?idx=1294422&bmode=view

내츄럴 브릿지 국립 기념물의 공룡 암각화들 

http://creation.kr/Dinosaur/?idx=1294504&bmode=view

아메리카 인디언들은 쥐라기의 공룡을 보았는가?

http://creation.kr/Dinosaur/?idx=1294521&bmode=view

고대의 페인팅 작업장은 인간의 진화이야기에 도전하고 있다. : 인간의 현대적 사고능력과 인지능력이 10만 년 전부터?

http://creation.kr/Apes/?idx=1852120&bmode=view

호주 원주민들은 언제부터 호주에 살게 되었는가?

http://creation.kr/BiblicalChronology/?idx=1289269&bmode=view

동굴 벽화를 그렸던 네안데르탈인은 완전한 현생인류였다!

http://creation.kr/Apes/?idx=1852253&bmode=view

석기시대의 동굴 벽화에 언어의 흔적? 

http://creation.kr/Apes/?idx=1852159&bmode=view

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://creation.kr/Apes/?idx=1852263&bmode=view

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

그리스에서 570만 년 된 사람 발자국의 발견? : 트라칠로스의 발자국으로 다시 써야하는 인류 진화론

http://creation.kr/Apes/?idx=1852249&bmode=view

고대의 방직공장? : 34,000년(?) 전의 고대인들이 만든 섬유가 발견되었다.

http://creation.kr/Apes/?idx=1852060&bmode=view

인류의 열처리 기술은 7~16만 년 전부터 시작됐다?

http://creation.kr/Apes/?idx=1852089&bmode=view

사람과 공룡이 함께 살았다는 증거들 6 : 그림, 문헌, 암벽화, 예술품에 등장하는 나는 용은 익룡이었다!

http://creation.kr/Dinosaur/?idx=1294632&bmode=view

사람과 공룡이 함께 살았다는 증거들 9 : 아프리카와 아메리카의 역사, 그림, 예술품에 등장하는 공룡!

http://creation.kr/Dinosaur/?idx=1294635&bmode=view

이카 돌의 진위 여부에 대한 심도 있는 조사.

http://creation.kr/Dinosaur/?idx=1294636&bmode=view

남북전쟁 시에 사냥된 익룡 사진에 관한 진실! : 위조된 사진을 유포시켜, 진짜 사진을 불신시키고 있다!

http://creation.kr/Dinosaur/?idx=1294637&bmode=view

빙하기를 초래한 노아의 홍수

http://creation.kr/IceAge/?idx=1288341&bmode=view

빙하기 탐구 - 멈춰버린 시간. 7장 : 창세기 대홍수에 의해 원인된 빙하기

http://creation.kr/IceAge/?idx=1288359&bmode=view

빙하기 탐구 - 멈춰버린 시간. 11장 : 단 한 번의 빙하기

http://creation.kr/IceAge/?idx=1288363&bmode=view

고대 호수 퇴적층과 기후 변화, 그리고 성경적 단서

http://creation.kr/IceAge/?idx=1288347&bmode=view

열대 다우림 화석들은 극적인 기후 변화를 증거하고 있다.

http://creation.kr/IceAge/?idx=1288344&bmode=view

홍수 모델은 남극대륙의 열대우림 미스터리를 풀 수 있다.

http://creation.kr/Catastrophic/?idx=4158791&bmode=view

한때 축축했던 사하라 사막의 미스터리 : 아프리카 습윤 기간은 노아 홍수로 쉽게 설명될 수 있다.

http://creation.kr/EvidenceofFlood/?idx=1288490&bmode=view

홍수로 드러난 빙하기 숲의 비밀

http://creation.kr/IceAge/?idx=3832418&bmode=view

창세기와 욥기에 기록된 기후와 일치되는 고고학적 발굴

http://creation.kr/archaeology/?idx=1288785&bmode=view


출처 : ICR, 2021. 1. 4.

주소 : https://www.icr.org/article/amazonian-artwork-post-flood-ice-age/

번역 : 미디어위원회

Warren Nunn
2020-10-27

그리스 트라칠로스에서 발견된 570만 년 전의 

완전한 사람발자국으로 붕괴되고 있는 인류 진화론 

(Cretan footprints stomp on human evolution Best explained by creation model)

Warren Nunn


     지중해에 있는 그리스 크레타(Crete) 섬의 트라칠로스(Trachilos)에서, 570만 년 전의 ”사람의 것으로 보이는” 화석 발자국들의 발견으로 진화론자들은 당황하고 있었다.

이것이 왜 논란이 되는 것일까? 진화론에 따르면, 그 시기에 인류의 조상은 아프리카에만 있었고, 원숭이 같은 발을 가졌으며, 약 360만 년 전까지는 직립보행을 하지 못했다고 주장해왔었기 때문이다.[3]

 

.연구자들이 조사했던 그리스 크레타 섬의 트라칠로스에서 발견된 사람발자국 중 하나. (Andrzej Boczarowski, fair use Trachilos-footprint)

발자국은 연구의 수석 저자인 제라드(Gerard Gierliński)에 의해서 2002년에 발견됐었다.[4] 3D 이미지를 얻기 위해서 두 개의 보행렬 표면은 레이저로 스캔되었고, 발자국에 대한 실리콘 캐스트도 제작되었다. 또한 다양한 측정들도 수행되었다. 연구자들은 발자국들은 '호미닌(hominin)'에 의해 만들어졌으며, 발자국을 만든 주체는 ”갈고리 발톱(claws)이 없고, 두 발로 걸었으며(bipedal), 발바닥 전체를 대고 걸었고(plantigrade), 다섯 개의 발가락을 가지고 있었으며(pentadactyl), 커다란 엄지발가락을 갖고 있다(entaxonic)”고 결론을 내렸다.[1]

일반인들에게 이들 발자국의 주인은 어떤 다른 생물이 아닌, 사람의 발자국으로 보인다.그러나

연구자들은 그 발자국들은 '호미닌(hominin)'에 의해 만들어졌다고 결론을 내렸다...

사람의 발은 매우 독특하기 때문에 분명히 구별된다. 사람의 발은 26개의 뼈들로 이루어져서, 충격을 흡수하는 기능, 발바닥 가운데가 구부러져서 밀 수 있는 기능 등과 같은 놀라운 설계로 되어 있다.[5]

저자 중 한 명은 말했다 :

”사람의 발은 다른 모든 육상동물과는 다른 매우 독특한 모양을 가지고 있다. 긴 발바닥, 발톱이 없는 5개의 앞쪽을 향한 짧은 발가락들, 다른 발가락보다 큰 엄지발가락, 등의 조합은 독특하다.”[6]

논문은 다음과 같이 말했다 :

화석 발자국들은 시공간적으로 발자국을 만든 존재에 대한 정보를 제공한다. 발자국들로부터 그것을 만든 존재를 추론하는 것은, 흔적과 원인 사이를 연결하기에 충분하고 독특한 형태학적 데이터가 있는 경우에는 가능하다.[1]

다른 말로 해서, 관찰자는 어떤 유형의 생물이 그것을 만들었는지를, 남겨진 발자국으로부터 어느 정도 확신을 가지고 추론할 수 있다는 것이다. 대부분의 사람들은 이 이미지를 보면서  즉각적으로 사람의 발자국이라고 결론짓는 것이 타당할 것이다.

 

.제라드(Gerard Gierliński)가 발견하고 조사했던 장소. (Andrzej Boczarowski)

저자들은 발자국들이 매우 사람의 발자국처럼 보임에도 불구하고, 조심하고 있었다 :

... 우리는 인간 진화(human evolution)에 대한 전통적인 견해에 상반될 수 있는 의미를 가진 사례를 보고한다.  ... [1]

”전통적인 견해에 상반될 수 있는 의미를 가진 사례”라는 말을 깊이 숙고해볼 필요가 있다. 왜냐하면 연구자들은 진화론적으로 받아들여진 '사실'에 도전하는 어떠한 발견도(극소수의 것만 제외하고) 의심스러운 것으로 간주될 것이라는 것을 알고 있기 때문이다.

연구자 중 한 명이 말했다 :

”인간의 기원에 대한 과학사회가 이 화석 발자국들을 중신세 크레타 섬에 호미닌이 존재했다는 결정적인 증거로 받아들일지 여부는 두고 볼 일이다.”[2]

성경적 창조론자들은 창세기에 기록된 것처럼, 모든 피조물들이 창조주간에 하나님의 명령에 따라 완벽하게 창조되었음을 알고 있기 때문에, 사람 발자국(또는 다른 생물)들이 발견된 것에 대해 놀라지 않는다. 따라서 창조론자들은 진화론자들과는 달리, 사람 발자국처럼 보이는 발자국은 실제로 사람에 의해서 만들어진 것이라는 사실을 받아들이는 데 문제가 없다.

우리는 이와 같은 화석을 만날 때, 성경에 기록된 이 세계의 진실된 역사를 사용하여, 그것을 해석한다. 이것은 지구상 도처에서 발견되는 수많은 화석들에 대한 가장 좋은 설명인 전 지구적 대홍수를 시사하고 있다.

따라서 창조론자들은 진화론자들과는 달리, 사람 발자국처럼 보이는 발자국은 실제로 사람에 의해서 만들어진 것이라는 사실을 받아들이는 데 문제가 없다.

이 발자국들의 발견은 매우 중요하다. 왜냐하면 이 발자국들은 사람이 그 시기에 이미 살았다는 것을 의미하기 때문이다. 그 발자국은 노아 홍수 이전의 사람이 만든 발자국일 수 없다. 왜냐하면 전 지구적 홍수로 인해 홍수 이전의 땅들은 두터운 퇴적지층 아래 묻혀버렸고, 노아 방주에 있던 단지 소수의 사람만이 살아남았기 때문이다. 크레타 섬의 발자국은 지질기록에서 매우 늦게 퇴적된 퇴적물에서 발견되었기 때문에, 홍수 이후에 만들어졌음이 분명하다. 그 발자국들을 만든 사람은 노아 홍수에서 살아남은 8명 중의 후손이었을 것이다.

따라서 성경은 이 세계의 참된 역사이기 때문에, 사람과 마찬가지로, 모든 피조물들은 원래 창조된 생물의 후손으로, 그 종류대로 번식해왔다는 것을 알 수 있다(창 1장). 따라서 크레타 섬에서 발자국들은 남긴 사람은 우리 모두처럼. 아담과 하와의 후손이었던, 노아와 그의 아내의 후손이었다.

*참조 : 그리스에서 570만 년 된 사람 발자국의 발견? : 트라칠로스의 발자국으로 다시 써야하는 인류 진화론
http://www.kacr.or.kr/library/itemview.asp?no=6691

라에톨리 발자국은 진화론과 조화되지 않는다 : 366만 년(?) 전의 발자국은 현대인의 것과 유사했다.
http://www.kacr.or.kr/library/itemview.asp?no=5180

라에톨리 발자국은 빠르게 침식되고 있는 중이다 : 370만 년 된 발자국이 30년 만에 사라질 위기?
http://www.kacr.or.kr/library/itemview.asp?no=4144

호모 에렉투스(150만 년 전)의 발자국은 현대인의 것과 동일했다.
http://www.kacr.or.kr/library/itemview.asp?no=4563

현대인의 발자국과 유사한 호모 에렉투스의 발자국
http://www.kacr.or.kr/library/itemview.asp?no=6425

수백만 년 전의 완전한 사람발자국의 발견? : 두 발자국에 관한 이야기
http://www.kacr.or.kr/library/itemview.asp?no=4007


Related Articles
New footprints from Ileret, Kenya, supposed to be from human evolutionary ancestor
Lucy: walking tall—or wandering in circles?
Evolutionists ‘go ape’ over new fossils
Homo erectus ‘to’ modern man: evolution or human variability?


Further Reading
Anthropology and Apemen Questions and Answers
‘Lucy’ isn’t the ‘Missing Link’!


Related Media

Laetoli Footprints


References and notes
1. Gierliński, G.D., et al., Possible hominin footprints from the late Miocene (c. 5.7 Ma) of Crete? Proc Geol Assoc, August 2017 | https://doi.org/10.1016/j.pgeola.2017.07.006. The paper’s abstract includes the phrase: The interpretation of these footprints is potentially controversial (emphasis added). *Our controversial footprint discovery suggests human-like creatures may have roamed Crete nearly 6m years ago (2017. 9. 1. The Conversation)
https://theconversation.com/our-controversial-footprint-discovery-suggests-human-like-creatures-may-have-roamed-crete-nearly-6m-years-ago-82326
2. MacDonald, C., The mystery trail of 5.7 million year old fossilised footprints in Greece that could shake up our understanding of human evolution, dailymail.co.uk, September 2017. One of the study’s authors, Professor Per Ahlberg, is quoted as saying, 'What makes this controversial is the age and location of the prints” (emphasis added).
3. Laetoli footprint trails, humanorigins.si.edu, accessed October 2017.
4. Swidel, J., Footprint find on Crete may push back date humans began to walk upright, news.com.au, September 2017.
5. Oard, M.J., New footprints from Ileret, Kenya, supposed to be from human evolutionary ancestor, March 2009; creation.com/ileret.
6. Fossil footprints challenge established theories of human evolution, sciencedaily.com, August 2017.

 

*참조 : 라에톨리 발자국은 진화론과 조화되지 않는다 : 366만 년(?) 전의 발자국은 현대인의 것과 유사했다.

http://creation.kr/Apes/?idx=1852118&bmode=view

라에톨리 발자국은 빠르게 침식되고 있는 중이다 : 370만 년 된 발자국이 30년 만에 사라질 위기?

http://creation.kr/Geology/?idx=1290530&bmode=view

라에톨리에서 새로운 사람 발자국들의 발견

http://creation.kr/Apes/?idx=2273260&bmode=view

현대인의 발자국과 유사한 호모 에렉투스의 발자국

http://creation.kr/Apes/?idx=1852230&bmode=view

유럽에서 발견된 사람 발자국이 80만 년 전의 것이라고?

http://creation.kr/Apes/?idx=1852187&bmode=view

수백만 년 전의 완전한 사람발자국의 발견? : 두 발자국에 관한 이야기

http://creation.kr/Apes/?idx=1852025&bmode=view

알렌 로이(Allen Roy)의 튜바시 공룡과 사람 발자국 사진

http://creation.kr/Dinosaur/?idx=1294419&bmode=view

거인과 공룡이 함께? : 같이 나 있는 공룡과 사람의 발자국

http://creation.kr/Dinosaur/?idx=1294455&bmode=view

공룡 아크로칸토사우르스의 발자국을 가로지르며, 겹쳐서 나있는 사람(여자)의 발자국

http://creation.kr/Dinosaur/?idx=1294439&bmode=view

버딕 발자국은 진짜다! : 진화론자들의 궤변을 반박한다!

http://creation.kr/Dinosaur/?idx=1294441&bmode=view

공룡 화석 탐사 보고서 : 남해군 가인리에 공룡발자국과 함께 나있는 사람발자국 추정 화석

http://creation.kr/Dinosaur/?idx=1294464&bmode=view

모리스 발자국(Morris Track)으로 알려진 백악기의 사람 발자국

http://creation.kr/Controversy/?idx=1294655&bmode=view

캄브리아기의 샌들 또는 신발 자국 : 사람 발자국에 삼엽충이?

http://creation.kr/Controversy/?idx=1294656&bmode=view

35만 년(?) 전의 완전한 현생인류의 발견으로 다시 써야하는 인간 진화론

http://creation.kr/Apes/?idx=1852263&bmode=view

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

마니시 두개골은 인류 진화 계통도를 뒤집어 버렸다 : 호모 에렉투스, 루돌펜시스, 하빌리스는 함께 살았다.

http://creation.kr/Apes/?idx=1852224&bmode=view

진화론적 유인원 개념이 붕괴되고 있다 : 호모 하빌리스와 호모 에렉투스가 1만4천 년 전에도 살았다?

http://creation.kr/Apes/?idx=1852218&bmode=view

사람 화석과 음식에 대한 의심스러운 오래된 연대 : 11만 년 전에도 호모 에렉투스가 살았다?

http://creation.kr/Apes/?idx=3001583&bmode=view

네안데르탈인은 결국 완전한 사람이었다 : 네안데르탈인의 폐활량은 현생인류보다 더 컸다.

http://creation.kr/Human/?idx=1757435&bmode=view

인류의 진화 이야기는 완전히 틀렸다! : 현생인류는 31만 년 전에 아프리카 전역에서 살고 있었다?

http://creation.kr/Apes/?idx=1852245&bmode=view

벼랑 끝에 선 인류의 ‘아프리카 기원설’ : 선호되던 인간 진화 이야기는 이제 고군분투하고 있다.

http://creation.kr/Apes/?idx=3630150&bmode=view

인간 진화론의 또 하나의 번복 : 인류의 탄생 장소는 아프리카가 아니라, 유럽이다?

http://creation.kr/Apes/?idx=1852247&bmode=view

그리스에서 570만 년 된 사람 발자국의 발견? : 트라칠로스의 발자국으로 다시 써야하는 인류 진화론

http://creation.kr/Apes/?idx=1852249&bmode=view

농업의 기원은 진화론적 장구한 연대를 부정한다. : 30만 년 전에 출현한 현대 인류가 1만 년 전에 농업을 시작?

http://creation.kr/BiblicalChronology/?idx=1289295&bmode=view

한 화석의 발견으로 또 다시 번복되고 있는 인류 진화 이야기 : 오스트랄로피테쿠스 아나멘시스와 아파렌시스는 공존했다.

http://creation.kr/Apes/?idx=2491152&bmode=view

인간의 진화 이야기는 실패를 계속하고 있다.

http://creation.kr/Apes/?idx=1852259&bmode=view

루시가 원숭이였다는 추가적 증거

http://creation.kr/Apes/?idx=1852261&bmode=view

사기의 한 세기 : 필트다운인 사기의 발견 50주년

http://creation.kr/Apes/?idx=1851912&bmode=view

자바인의 실체

http://creation.kr/Apes/?idx=1851863&bmode=view

호모 나레디 3 : 새로운 고대 인류가 될 수 없는 이유

http://creation.kr/Apes/?idx=1852203&bmode=view

호모 나레디 2 : 주장되는 유인원의 이상한 추정 연대

http://creation.kr/Apes/?idx=1852201&bmode=view

호모 나레디는 오래되지 않았다! : 또 다시 기각된 새로운 유인원.

http://creation.kr/Apes/?idx=1852241&bmode=view

데니소바인은 다시... 현생인류로 보인다?

http://creation.kr/Apes/?idx=1852255&bmode=view

사람은 유인원에서 진화했는가?

http://creation.kr/Apes/?idx=1852235&bmode=view

140만 년 전(?) 도구를 만들 수 있는 사람 손뼈의 발견.

http://creation.kr/Apes/?idx=1852171&bmode=view

인류의 조상 아담이 오스트랄로피테쿠스인가요?

http://creation.kr/Apes/?idx=1852216&bmode=view

인류의 조상은 결국 모두 한 종이었다! : 완전히 붕괴되고 있는 인류 진화 계통도

http://creation.kr/Apes/?idx=1852167&bmode=view

원숭이-인간 진화는 신화이다.

http://creation.kr/Human/?idx=1757436&bmode=view


번역 - 미디어위원회

링크 - https://creation.com/controversial-crete-footprints

출처 - CMI, 2017. 10. 26.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6759

참고 : 2769|2387|2523|2712|2149|3093|3989|3988|3890|3867|3848|3834|3656|3431|3419|4000|4053|4176|4266|4315|4372|4410|4432|4498|4499|4593|4626|4650|4660|4682|4709|4720|4751|4763|4785|4812|4820|4824|4833|4842|4847|4880|5025|5051|5129|5157|5155|5218|5334|5349|5375|5406|5455|5492|5496|5507|5525|5528|5701|5730|5768|5792|5796|5802|5818|5819|5884|5918|5948|6052|6058|6190|6243|6250|6251|6253|6271|6292|6423|6476|6521|6605|6606|6621|6623|6691

미디어위원회
2020-08-20

끝까지 버티는 다윈의 신화

: 흔적기관과 침팬지와 유사성이 98.8%라는 거짓 주장

(Darwin Myths Die Hard)

Jerry Bergman


      진화론의 신화는 부정된 후에도 오랫동안 지속된다. 어떤 경우에는 150년 이상!


   인간의 기원에 대한 다윈의 이야기를 뒷받침하는 진화론적 신화들은 위조로 판명된 이후에도 대중에게 무비판적으로 받아들여지는 경향이 있다. 다음은 몇 가지 예이다.


흔적기관

하나의 예는, 사람 눈에서 "깜박막(nictitating membrane, 순막)"으로 주장됐던 것이다. 이것은 먼 진화론적 조상으로부터 남겨진 흔적기관이라는 것이었다. 라틴어로 눈 깜박임(nictare)에서 유래한 깜박막은 시력을 유지하면서, 눈을 먼지로부터 보호하고, 수분을 공급하기 위해 눈을 가로질러 움직일 수 있는, 투명한 제3의 눈꺼풀이다. 다윈은 이 구조에 관해 설명하면서, 파충류가 우리의 조상이라는 증거로 사용하였다.

.2019년 발간된 제리 버그만의 책, ‘쓸모없는 기관 : 진화론의 한 중심적 주장의 흥망성쇠(Useless Organs : the Rise and Fall of a Central Claim of Evolution)’ 


그러나 1920년대에 주장됐던 사람 눈에서의 깜박막은 사실 깜박거리는 막도 아니고, 흔적기관도 아니었다. 그것은 반월주름(plica semilunaris, 반달모양의 주름)이었다. 그것은 매우 다른 목적을 갖고 있는 매우 다른 구조였다. 반월주름은 눈의 내안각에 있는 작은 결막 조직의 주름으로, 눈물의 배수를 유지하고, 안구의 회전을 더욱 원활하게 해준다.[1] 실제로 이 반월주름이 없다면, 결막은 안구에 직접 부착되어 움직임이 제한된다.[2] 이 잘못된 깜박막 개념은 1871년 찰스 다윈(Charles Darwin)이 아닌 다른 누군가에 의해 시작되었다. 하지만, 그것은 여전히 1세기 반이 지나서도 흔적기관의 주요한 예로써 계속 선전되고 있는 것이다![3] 권위 있는 브리태니커 백과사전(Encyclopedia Britannica)은 흔적기관 목록에서 4번째로 깜박막을 올려놓고 있다![4] 브리태니커 백과사전은 흔적기관을 “진화 역사의 잔존물”로 설명하고 있다.


1% 라는 신화

최근 비즈니스 인사이더(Business Insider) 지는 또 다른 다윈의 신화를 강조해서 말하고 있었다. “우리의 유전자(DNA)는 바로 옆 사람과 99.9%가 동일하다. 인간의 유전자는 놀랍게도 다른 생물의 유전자와도 많이 비슷하다.” 그 기사는 침팬지와 키스하고 있는 영장류 과학자 제인 구달(Jane Goodall)의 사진과 함께 소개되고 있었다. 애니메이션의 삽화와 강조된 굵은 글씨를 사용하여, 유사성 목록(list of similarities)을 만들어 다윈주의를 선전하고 있었다.

• 인간과 인간의 유전적 유사성은 99.9%이다.

• 인간과 침팬지의 유전적 유사성은 96%이다.

• 인간과 고양이의 유전적 유사성은 90%이다.

• 인간과 쥐의 유전적 유사성은 85%이다.

• 인간과 젖소의 유전적 유사성은 80%이다

• 인간과 초파리의 유전적 유사성은 61%이다.

• 인간과 닭의 유전적 유사성은 60%이다.

• 인간과 바나나의 유전적 유사성은 60%이다.[5]

이것은 인간과 진화론적으로 먼 친척들로부터 가까운 생물들을 배치하면서, 우리가 진화론적으로 진보하여 왔음을 홍보하려는 뻔뻔한 시도이다. 그들의 주장에 의하면, 인간과 닭의 유전적 거리가 인간과 바나나와의 거리와 같다고 결론내리고 있는데, 얼마나 터무니없는 것인가? 그러나 자세히 들여다보면, 이 기사의 문제점은 인간과 쥐 사이의 85% 유사성은, 단지 단백질을 인코딩하는 유전자(protein-encoding genes)만을 비교한 것이다. 단백질을 코딩하지 않는 유전자(non-protein coding genes)의 경우, 유사성은 단지 약 50%에 지나지 않는다. 실제로 인간과 침팬지를 비교하기 위해서는, 이런 부분이 강조되어야 한다. 일반 독자는 제목만 보고, 정작 그 안에 있는 중요한 사실을 놓치게 된다.

구글에서 검색해보면, 침팬지와 인간의 유전적 유사성은 95%, 심지어 99%라고 쓰고 있는 수천의 글들을 보게 된다. 그러한 주장은 책 제목으로도 발견되는데, ‘인간과 침팬지 : 인간과 침팬지의 유전자는 96% 유사하다’라는 책도 있다.[6] 이 책에서 “연구자들은 침팬지의 유전자 염기서열을 분석했으며, 사람과 침팬지는 96%가 유사하다는 것을 발견했다. 모두가 알아야 할 매우 흥미로운 정보이다”라고 말한다. 또 다른 제목의 책은 “99% 원숭이: 진화는 어떻게 발전하는가”이다.[7] 이 책은 제목에서부터 ‘인간은 원숭이와 99% 같다’라고 주장하고 있다. 이런 잘못된 주장을 일부 유신진화론자(theistic evolutionists)들은 받아들이고 있다. 예를 들어, 캐나다에서 가장 큰 기독교대학의 생물학 교수이며, BioLogos의 유신진화론자인 데니스 베니머(Dennis Venema)는 다음과 같이 썼다. “우리 전체의 유전체가 침팬지와 95% 혹은 98% 동일하다고 하는 것의 의미는 우리의 유전자 가운데 작은 DNA 블록들이 얼마나 소실되었는가에 달려있다.”[8]

마찬가지로, 단 1%의 차이라는 신화는 선도적 과학 잡지들에서 끊임없이 반복되고 있다. Smithsonian Magazine의 ‘현재 상태를 유지하는 현명한 소식’이라는 제목의 기사에서 "99% 침팬지라는 것은 무엇을 의미할까?"라고 묻고 있다. 그런 다음 그 기사는, 그것이 의미하는 바는, 즉 우리 인간은 99% 침팬지라는 것이다. 가장 권위 있는 과학저널에서도 이런 잘못된 거짓 신화는 구역질날 정도로 반복되고 있다. Scientific American의 기사는 “대부분의 연구에서 침팬지와 인간 사이에서 유전체가 비교됐을 때, 약 98.5%의 염기서열이 동일하다는 것이 밝혀졌다”고 말한다.[9] 또 다른 예로, Science 지는 “2005년 침팬지의 유전체가 분석된 이후로, 인간과 침팬지의 유전자는 약 99%를 공유하고 있고, 침팬지는 우리의 가장 가까운 친척이다”라고 말하고 있었다.[10] 마지막 예로, Nature 지의 한 보고는 “우리 DNA의 거의 98% 이상이 가장 가까운 살아있는 친척인 침팬지와 같다”고 쓰고 있었다.[11]


1%라는 주장이 산산조각 남

그러나 이러한 주장은 최근의 연구에 의해 산산조각이 났다. 미국을 대표하는 과학 잡지인 Science 지의 한 기사는 “상대적 차이: 1%라는 신화”라는 제목의 글을 보고했다.[12] 이 기사는 올해 발표된 것이 아니다. 이 논문은 13년 전인 2007년에 게재됐던 것이다! 그러나 그 이후에도 그러한 신화는 책들과 기사들에서 반복되어왔던 것이다! 저자는 1% 라는 주장이 처음부터 문제가 있었다고 설명하고 있었다 :

2005년에 침팬지 시퀀싱 및 분석 컨소시엄(Chimpanzee Sequencing and Analysis Consortium)의 연구자들은 우리와 가장 가까운 친척인 침팬지의 유전체를 연구하여, 가장 극적인 증거들을 발표했다. 컨소시엄 연구자들은 인간과 침팬지 각각에서 24억 개의 염기서열을 분석했으며, 이들이 1.23 %의 차이를 나타낸다고 보고했다. 그러나 침팬지 컨소시엄이 지적한 바와 같이, 이 수치는 유전체에 삽입되거나 삭제된 유전자(DNA) 전체가 아니라, 단지 염기가 치환(base substitutions)된 것만을 반영한 것이었다.[13]   

더 심도 깊은 연구는 훨씬 큰 차이가 있음을 밝혀냈다. "한(Hahn) 및 동료들은 2006년 12월 PLoS ONE 지에 발표된 논문에서, 인간과 침팬지 유전자 복사본의 수(gene copy numbers)는 무려 6.4%의 많은 차이가 났다"고 밝혔다.[14] 그리고 그들은 시스템 생물학(systems biology)을 이용하여, 인간과 침팬지 뇌의 유전적 차이를 정량화하고 분석했다. UCLA 생물 통계학자 스티브 호르벳(Steve Horvath)과 게쉬윈드(Geschwind)는 절제된 뇌의 특정 영역에서 4,000여개의 유전자들이 동시에 켜지거나, "동시 발현된" 유전자를 비교했다. 이러한 데이터를 바탕으로, 각 종(種)에 대한 유전자 네트워크를 구축했다. 그들은 “네트워크에서 한 유전자의 위치는 커다란 의미를(유사성 비율은 매우 제한적임을) 갖는다”라는 결론을 내렸다. 다른 유전자와 가장 빈번하게 공동 발현되는 유전자들은 가장 기능적으로 관련 있는 것으로 밝혀졌다.[15] 그리고 2006년 기사에서 “각 생물 종의 각각의 군집 네트워크 지도(map)에 대한 비교는 특정 연결이 인간에게는 있지만, 침팬지에는 존재하지 않음을 분명히 보여주었다. 예를 들어, 피질(cortex)에서 이런 연결의 17.4%는 인간에게만 고유한 것이다.”[16]

지금은 2020년이다. 그래서 인각과 침팬지의 유사성 문제는 확실히 해결되었다. 그렇다면 정확히 몇 %가 다르다고 말할 수 있을까? 이에 대해서는 2007년 기사를 인용하는 것이 좋을 것이다 :

연구자들이 밝혀낸 모든 것을 결합하여, 인간과 침팬지의 차이를 정확하게 몇 %라고 말할 수 있을까? 침팬지 컨소시엄의 한 연구자인 독일 라이프치히의 막스플랑크 진화인류학 연구소(Max Planck Institute of Evolutionary Anthropology)의 유전학자 스반테 파보(Svante Päabo)는 “나는 숫자를 계산할 방법이 없다고 생각한다. 결국, 우리가 차이점을 보는 방법은 정치적, 사회적, 문화적 문제이다.”

이것은 이 이슈에 대해 잘 설명하고 있으며, 13년 전에 대중에게 들려졌어야 했다. “결국 우리가 차이점을 보는 방법은 정치적, 사회적, 문화적 문제이다”라는 스반테 파보(Svante Päabo)의 말은 정확한 것이다. 1%의 차이라는 주장은 과학이 아니라, 정치적 목적을 위한 과학의 심각한 왜곡이다. 그 기사는 “오늘날 두 종은 유전적으로 99% 동일하다는 것으로 받아들여지고 있다.” 그리고 “1%의 차이는 자명한 이치라는 주장은 철회되어야 한다”고 덧붙였다. 지난 13년 동안 진화론자들은 이런 현명한 사람들의 충고를 무시했다.


최신 연구

더 자세한 최근 연구에 따르면, 최상의 유전자 비교 추정치는 99%, 95%, 또는 90%가 아니라, 약 84%의 유사성에 불과하다는 것이다. 16%의 차이는 약 5천만 개의 염기쌍이 다르다는 것을 나타낸다.[17] 23개의 인간 염색체의 길이는 약 1.8m로, 적절한 길이로 나누어 시퀀싱을 하고, 조립하여 분석한다. 초기 DNA 시퀀싱 작업에서, 과학자들은 매우 짧은 DNA 분절(segments)에 대해서만 염기서열을 분석할 수 있었다.

따라서 연구자들은 혈액 글로빈(globin) 단백질과 같은, 동물들 사이에서 매우 유사할 것으로 생각되는 DNA 분절에 초점을 맞추었다. 그러나 이 유전자들에서도 문제가 있었다. 침팬지 유전체(genome)은 인간 유전체보다 훨씬 길다 : 인간 유전체에는 3,096,649,726개의 염기쌍이 있고, 침팬지 유전체에는 3,309,577,922개의 염기쌍이 있다. 즉 6.4%의 개수 차이가 난다.[18] 더군다나, 인간은 46개의 염색체를 갖고 있고, 침팬지는 48개의 염색체를 갖고 있다. 따라서 아래와 같이(첫 번째 줄과 두 번째 줄 사이에) 거의 일치하지 않는 두 염기서열의 유전자를 비교하는 것은 어렵다 : 

ATTTGGGGTCCTTTTCCCGTAGTAACCTTCCCAAATGTTTGGCATCGTACGCTG

AAGGGTTGGGGAATATAGGGCGCGCGTATAGCGCGTGTGTTCTCTCGTACTAA

진화론자들은 이러한 거대한 차이가 나는 부분을 무시하고, 유사성에 초점을 맞추는 경향이 있다. 또한 비코딩 영역(non-coding regions)은 중요한 조절 기능을 갖고 있는 것으로 확인되고 있다. 이것이 확인되기 전까지 '정크(쓰레기) DNA(junk DNA)'라고 불렸었다.

여기 또 다른 오류가 있다. 인간에는 존재하지만, 침팬지에는 존재하지 않는 DNA 염기서열은 의미 있는 비교를 할 수 없게 만든다. 따라서 비교는 주로 헤모글로빈과 같은, 혈액 세포 단백질의 암호가 들어있는 유전자 영역을 비교하는 것이었다. 헤모글로빈이 기능하기 위해서는, 단백질이 매우 특정한 모양이어야 하기 때문에, 그들은 매우 유사한 유전자를 가질 것으로 예상될 수 있다. 결과적으로, 동일한 기능적 유사성을 필요로 하는 종들 사이에는 상당한 유사성이 존재할 수 있다. 그러나 중요하지 않다고 생각하는, 비코딩 영역은 훨씬 많은 차이를 보여주고 있음에도, 코딩 영역만으로 유사성을 주장한다면, 전체 유전체의 유사성은 상당히 왜곡되는 것이다.

그리고 일부 연구자들의 연구는 일종의 사기(fraud)인 것이다. 침팬지 염기서열을 분석한 한 실험실은, 진화론적 가정에 기초하여, 침팬지에는 없는(존재하지 않는) 염기서열이 있는 유전자의 경우, 그 간격을 메우기 위해서 침팬지 유전체에 인간 DNA 염기서열을 삽입했음을 인정하고 있었다. 따라서 논문으로 보고된 침팬지 유전체의 염기서열 분석은 부분적으로 인간 유전체를 기반으로 한 것이므로, 결과적으로 실제보다 훨씬 더 인간에 가까운 것으로 보여지는 것이다!

또 다른 주의해야할 사항은 단백질 암호를 갖고 있는 코딩 유전자는 선택적 접합(alternative splicing, 선택적 스플라이싱, 잘라붙임)을 통해, 많은 다른 개별 m-RNA 변이체들을 생산해낼 수 있다. 예를 들어, 단지 30,000개 이하의 유전자로 백만 가지 이상의 단백질들을 만들어낼 수 있으며, 이는 인간에 존재하는 것으로 추정되는 유전자의 수에 가깝다. 이러한 변이체들 중 다수는 후성유전학적(epigenetic) 메커니즘을 통해 생산된다.

따라서 인간 유전자와 침팬지 유전자는 유사성이 있다 하더라도, 발현되는 단백질들에서 큰 차이를 만들어낼 수 있다. 인간과 침팬지의 후생유전학적 차이는 유전자 자체의 차이보다 훨씬 클 가능성이 높다. 이 몇 가지 요점들은 인간과 침팬지 유전자형 사이에 커다란 간격이 존재하며, 이는 인간과 침팬지 표현형 사이에 존재하는 간격을 설명하는데 도움이 된다.


요약

다윈의 신화에 대한 이 두 가지 사례(눈의 흔적기관과 인간과 침팬지의 1% 차이)는 필자의 책에서 보고했던 많은 진화론의 오류, 사기, 위조들 중 하나이다. 그들은 모두 하나의 공통점을 갖고 있다. 즉, 진화론자들은 강한 동기를 갖고 진화론을 과학적으로 그럴듯하게 보이기 위해 애쓰고 있다는 것이다. 우리가 보았듯이 사실은 그렇지 않다. 그럼에도 불구하고, 많은 진화론의 신화들은 과학자들과 언론 기자들에 의해서 대중에게 계속 호도(糊塗)되고 있는 것이다.

.2017년 제리 버그만의 책, '진화론의 사기, 실수 및 위조(Evolution's Blunders, Frauds and Forgeries)'.



References

[1] Bergman, Jerry. 2019. Useless Organs: The Rise and Fall of the Once Major Argument for Evolution. Tulsa, OK: Bartlett Publishing.

[2] Dartt, Darlene A. 2006. “The Conjunctiva—Structure and Function.” Chapter 2 in Duane’s Foundations of Clinical Ophthalmology.  Philadelphia, PA: Lippincott Williams & Wilkins.

[3]  Darwin, Charles. 1871. The Descent of Man, and Selection in Relation to Sex. London, England, UK: John Murray, pp. 23, 207 in Volume 1.

[4] Rogers, Kara. “7 Vestigial Features of the Human Body.” Encyclopaedia Brittanica. https://www.britannica.com/list/7-vestigial-features-of-the-human-body

[5] Lydia Ramsey and Samantha Lee, “Our DNA is 99.9% the same as the person next to us — and we’re surprisingly similar to a lot of other living things.” Business Insider, April 3, 2018.

[6]  [Could not locate cited source. An alternate suggested reference: https://www.genome.gov/15515096/2005-release-new-genome-comparison-finds-chimps-humans-very-similar-at-dna-level.]

[7] Silvertown, Jonathan (ed.). 2009. 99% Ape: How Evolution Adds Up. Chicago, IL: The University of Chicago Press.

[8] The BioLogos Forum. https://discourse.biologos.org/t/human-chimp-genome-similarity/38409.

[9] Deininger, Prescott. 2004. What does the fact that we share 95 percent of our genes with the chimpanzee mean? And how was this numbered derived?  Scientific American. March 1. https://www.scientificamerican.com/article/what-does-the-fact-that-w/

[10] Gibbins, Ann. 2012. Bonobos Join Chimps as Closest Human Relatives. Science. June 13.  https://www.sciencemag.org/news/2012/06/bonobos-join-chimps-closest-human-relatives

[11] Gunter, Chris, and Ritu Dhand. 2005. The chimpanzee genome. Nature 437: 47, September 1. https://www.nature.com/collections/srwbvyfghj.

[12] Cohen, Jon. 2007. “Relative Differences: The Myth of 1%.” Science 316:1836, June 29.

[13] Cohen, 2007, p. 1836.

[14] Cohen, 2007, p. 1836.

[15] Cohen,  2007, p. 1836. Emphasis added.

[16] Cohen,  2007, p. 1836.

[17] Bergman, Jerry. 2020. Apes as Ancestors: Examining the Claims About Human Evolution. Tulsa, OK: Bartlett Publishing. Co-Authored with Peter Line, Ph.D., and Jeffrey Tomkins, Ph.D. Chapter 5: “Are Humans and Chimps 98% Similar?” Jeffrey Tomkins, Ph.D. & Jerry Bergman, Ph.D.

[18] http://useast.ensembl.org/Homo_sapiens/Info/Annotation.


*Dr. Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology for over 40 years at several colleges and universities including Bowling Green State University, Medical College of Ohio where he was a research associate in experimental pathology, and The University of Toledo. He is a graduate of the Medical College of Ohio, Wayne State University in Detroit, the University of Toledo, and Bowling Green State University. He has over 1,300 publications in 12 languages and 40 books and monographs. His books and textbooks that include chapters that he authored are in over 1,500 college libraries in 27 countries. So far over 80,000 copies of the 40 books and monographs that he has authored or co-authored are in print. For more articles by Dr Bergman, see his Author Profile.


*관련기사 : 인간과 DNA 98.8% 일치하는 침팬지 (중앙일보. 2020. 1. 4)

https://news.joins.com/article/22257317


*참조 : 사람과 침팬지의 DNA 유사성이 98% 이상인가? 그렇지 않다.

http://creation.kr/Variation/?idx=1290341&bmode=view

인간의 2번 염색체에서 융합은 결코 일어나지 않았다 : 사람과 원숭이류의 염색체 수 차이에 대한 진화론적 설명의 실패

http://creation.kr/Apes/?idx=3876591&bmode=view

보노보 유전체 해독에서 반-진화론적 비밀 : 유사한 영역만 비교하여 98.7%가 유사하다?

http://creation.kr/Apes/?idx=1852163&bmode=view

사람과 원숭이의 유전자 차이는 이전 보고의 4배

http://creation.kr/Mutation/?idx=1289754&bmode=view

사람과 침팬지 사이의 유전적 차이가 재계산되었다. 

http://creation.kr/Apes/?idx=1852205&bmode=view

1%의 신화 : 인간과 침팬지의 DNA는 매우 다르다.

http://creation.kr/Apes/?idx=1852185&bmode=view

사람과 침팬지의 Y 염색체 차이는 30% 이상이었다. 

http://creation.kr/Apes/?idx=1852097&bmode=view

진화론자들의 Y 염색체 충격 : 침팬지와 사람의 Y 염색체는 ‘끔찍하게’ 달랐다.

http://creation.kr/IntelligentDesign/?idx=1291705&bmode=view

사람과 침팬지의 DNA가 유사하다면, 왜 그렇게 많은 육체적 정신적 차이가 있는가?

http://creation.kr/Variation/?idx=1290374&bmode=view

사람과 침팬지의 DNA는 완전히 달랐다.

http://creation.kr/IntelligentDesign/?idx=1291692&bmode=view

사람 lincRNA 유전자는 진화론을 부정한다. : 침팬지의 lincRNA와 차이는 20% 이상이었다.

http://creation.kr/IntelligentDesign/?idx=1291733&bmode=view

또 하나의 진화론적 상징물이 무너졌다 : 진화론자들도 인간과 침팬지 DNA의 99%가 유사하다는 생각을 단념하다

http://creation.kr/Apes/?idx=1852048&bmode=view


출처 : CEH, 2020. 5. 27.

주소 : https://crev.info/2020/05/darwin-myths-die-hard/

번역 : 미디어위원회





















서울특별시 종로구 창경궁로26길 28-3

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 박영민

사업자번호 : 120-87-70892

통신판매업신고 : 제 2018-서울중구-0764 호

주소 : 서울특별시 종로구 창경궁로26길 28-5

대표전화 : 02-419-6484

개인정보책임자 : 김광