태초에 하나님이 천지를 창조하시니라 (창세기 1:1)

LIBRARY

KOREA  ASSOCIATION FOR CREATION RESEARCH

창조설계

미디어위원회
2020-02-11

세포 내의 초정밀 분자기계들이 모두 우연히? 

(Molecular Machines Work for Us)

David F. Coppedge


     생명체는 기계처럼 작동한다. 우리를 활기차게 유지시켜주는 분자기계들의 예는 다음과 같다.


분자기계는 독성 단백질 덩어리를 찢어낸다.(Phys.org. 2020. 1. 29). 단백질이 엉키면, 쓸모없는 분자가 될 뿐만 아니라, 세포를 혼란스럽게 만들어서, 심각한 질병을 일으킬 수 있다. 다행히도 그것을 풀어줄 수 있는 기계가 있다. ClpB(Caseinolytic peptidase B protein homolog)라 불리는 이 분자기계는 “노출된 단백질 사슬고리를 강제로 잡아당겨, 단백질 덩어리에서 풀어낼 수 있다.” AMOLF의 샌더 탠스(Sander Tans)는 다음과 같이 설명한다 :

“우리는 고리 모양의 ClpB 단백질이 중심 구멍을 통해 단백질 사슬고리를 강제로 끌어당기는 것을 발견했다. 이러한 단백질 사슬 루프는 단백질 덩어리의 표면에 존재한다. 그러나 이러한 덩어리는 너무 커서 기공을 통과하지 못한다. 따라서 이러한 당김 작용을 통해, ClpB는 개별 단백질 사슬을 더 큰 응집체에서 끌어낼 수 있다. 제거되면, 단백질 사슬은 다시 접히고, 정상적으로 기능할 수 있다. 모든 단백질들을 하나씩 뽑아냄으로써, 샤페로닌(chaperone)은 전체 응집체를 완전히 풀 수 있다.”


세포의 탄력적 코일은 RNA의 격발을 흡수한다.(Phys.org. 2020. 1. 30). 라이스 대학(Rice University)의 과학자들은 왜 DNA의 전사(transcription)가 꾸준한 속도가 아닌, 갑자기 돌발적으로 발생하는지를 궁금해 했다. 답은 DNA의 슈퍼코일의 탄력성과 관련이 있었다. 전사 기계인 RNA 중합효소(RNA polymerase)는 일련의 탄력적 격발로 DNA 가닥을 따라 도약하고 있었다.

한 연구자는 말했다. “RNA 중합효소는 RNA 생산을 시작하기 위해서 DNA를 감고 있다고 생각된다. 그 과정이 시작될 때, 격발(burst)이 발생하지만, 그 과정은 스프링을 압착함으로서 속도가 느려진다. 그러면 자이레이스(gyrases, DNA의 이중 나선을 슈퍼 코일화하는 효소)가 들어온다. 그들은 이 슈퍼코일을 풀어 정상적 생산을 다시 시작할 수 있게 한다. 동시에 자이레이스는 중합효소의 반대편에서 발생하는 부정적 스트레스를 완화시킨다”


변형된 RNA는 DNA에 직접적으로 영향을 미친다.(Phys.org. 2020. 1. 29) 분자생물학자들은 전사(transcription)가 양방향 도로(two-way street)라는 것을 깨달았다. RNA 중합효소(RNA polymerase)가 유전자를 읽고, 전령 RNA(messenger RNA)를 생성함으로서, RNA는 DNA에 영향을 미친다. 이 기사의 다이어그램은 이 과정에서 RNA 중합효소와 함께 작동하는 여러 분자기계들, 예를 들어, DNA 가닥을 자르는 핵산가수분해효소(nuclease), 가닥을 푸는 나선효소(helicase), 전사된 mRNA를 조절하는 리보핵산가수분해효소 P(Rnase-P)와 다른 분자기계들, 엑손을 제거하고 인트론을 재배열하는 스플라이세오좀(spliceosome) 등과 같은 것들을 보여준다.


‘부서진’ 세포들은 스스로 고쳐진다.(Phys.org. 2020. 1. 28). 침입자가 세포막에 구멍을 뚫으면, 세포는 손상을 복구할 수 있다. 몬트리올 대학(University of Montreal)의 연구자들은 “세포는 막 지방 (지질)을 더 액체 형태로 뒤섞어서, 구멍을 고칠 수 있다”고 밝혔다.


휴지기 상태의 과분극화 구조는 2-기공 채널 3(two-pore channel 3)를 활성화한다.(PNAS. 2020. 1. 28) 분자기계를 더 자세히 알고 싶어하는 사람들은, 과학자들이 어떻게 전압 게이트 막 채널의 휴식상태를 이미지화 할 수 있었는지 읽어보라. 이 채널들은 전하에 기초하여, 매우 비슷한 이온들을 구별할 수 있다. 채널의 급속한 탈분극은 활동전위(action potential)가 막을 따라 이동하게 한다. 과학자들은 이 고감도 분자기계의 휴식상태의 구조를 발견했다.

이 구조는 나트륨 선택성을 위한 화학적 기초를 제공하며, 수축된 게이트는 극도의 전압 의존성과 일치하는 닫힌 기공을 나타낸다.

이 채널은 신경과 근육에 신호를 전달하기 때문에, 동물의 삶에 있어서 극히 중요하다.


혈관 막에 있는 수용체: 기계감응 GPCR (Medical Xpress. 2020. 1. 31). 기사 상단의 이 분자기계에 대한 도형은 지적설계를 유추하기에 충분하다. 그리고 그 기능에는 더 많은 설계의 증거들이 있다. 이 기계감응 G 단백질 결합수용체(mechanosensitive G-protein coupled receptor, GCPR)의 7 포인트 방사형 대칭은 우리를 살아있게 한다. 혈관 막에 위치하는 그들은, 혈관을 확장시키거나 수축시켜 접촉에 반응한다. 뮌헨대학의 연구자들은 “이러한 기계적 힘이 H1R 수용체를 활성화하는 것을 발견했다. 이것은 차례로 일련의 반응들을 일으켜, 결국 혈관을 확장시켜 조직으로의 혈액 공급을 증가시킨다.”

--------------------------------------------------------


이러한 고도로 정밀한 초미세 분자기계들이 모두 우연히 생겨났을까? 시간을 거슬러 올라가 과거의 철학자들에게 세포 내의 분자기계들에 대해 이야기해준다면 얼마나 멋진 일일까? 로버트 훅과 레벤후크 이전의 과학자들은 세포 내부에 수천 개의 분자기계들은 물론이고, 세포가 존재한다는 사실조차 알지 못했다. 그들이 2020년의 과학자들처럼 10억 분의 1미터 크기의 물체를 볼 수 있고, 세포 내의 분자기계들이 사람이 만든 기계처럼(사실 더 빠르고 효율적으로) 작동되고 있는 모습을 관측한다면, 엄청나게 놀랄 것이 확실하다.  그들은 생명의 기초에 대해 너무도 잘못 생각했었다는 것을 깨달을 것이고, 분자들을 회전시키고, 격발시키고, 끌어당기는 분자기계에 대해 더 많은 것을 배우고 싶어할 것이다. 하지만 다윈은 부끄러움으로 인해, 어두운 골방으로 들어가 숨으려할 것이다.


*참조 : 자료실/창조설계/생명체

http://creation.kr/LIfe

자료실/창조설계/지적설계

http://creation.kr/IntelligentDesign


출처 : CEH, 2020. 1. 30.

주소 : https://crev.info/2020/01/molecular-machines-work-for-us/

번역 : 미디어위원회

미디어위원회
2019-12-18

세포도 인간 공학자처럼 제어 이론을 사용하고 있다! 

(Cells and Designers Both Use Control Theory) 

by Randy J. Guliuzza, P.E., M.D.


     새로운 한 연구는 생물이 어떻게 자신의 환경을 적극적으로 감지하고, 적응하는지를 설명하는 데, 첫 걸음을 시작하고 있었다. 몇몇 생물체는 한 메커니즘을 통해서, 변화하는 영양소의 농도, 호르몬, 또는 스트레스의 노출 수준을 추적한 다음, 필요할 경우 적절한 대응을 할 수 있다. 애리조나 대학의 앤드류 카팔디(Andrew Capaldi)는 이 놀라운 발견을 Nature Communications 지에 보고하고 있었다.[1] 그의 결과는 생물학적 기능들은 공학 원리에 의해 가장 잘 설명된다는, ICR의 주장을 지지하는 추가적 증거가 되고 있다.[2]

카팔디 팀은 효모(yeast) 종인 Saccharomyces cerevisiae에 들어있는 선천적 메커니즘을 사용하여, 몇몇 대사 경로가 조절된다는 가설을 테스트하기 위한 실험을 수행했다. 이는 인간 엔지니어가 설계한 제어이론 시스템과 유사한 것이다.

제어이론(control theory)은 매우 간단하다. 세 단계, 즉 1)입력되는 과정(물질 또는 정보), 2)입력된 것을 처리하는 과정, 3)출력물을 생산하는 과정을 조절하기 위해서, 인간 엔지니어는 그 시스템을 여러 센서 및 논리적 명령들로 연결해야 한다. 시스템을 정상 상태로 유지하려면, 어떤 센서가 그 출력물이 목표치와 편차가 있는지를 모니터링 할 필요가 있고, 중간 단계를 조절하기 위해 피드백 신호(feedback signal)를 보내는 과정이 있어야 한다. 또 다른 센서는 외부 환경에서 입력 물질의 급격한 변화를 모니터링 하고, 피드포워드 신호(feedforward signal)를 보내 처리 단계를 가속화하거나 느려지게 한다. 이 시스템은 "견고함" 및 "유연함" 모두를 갖추어, 변화할 수 있는 "탄력적인" 특성을 갖는다.

카팔디의 데이터는 효모 세포에서 2개의 대사 경로가 한 통합된 조절 회로에서 구별되는 역할을 한다는 것을 보여주었다. 제1 경로(TOR)는 대사와 관련된 출력물에 대한 정상 상태의 유전자 발현수준을 조절하고 있었다. 제2 경로(PKA)는 효모가 주요 외부 영양분인 글루코스 농도의 변화에 신속하게 적응할 수 있도록 해주는, 급속한 성장 및 중지 상태로의 전환이 일어나도록 유전자 발현을 조절하고 있었다.

카팔디의 팀은 효모에서의 대사 조절이 실제로 공학 원칙으로 가장 잘 설명된다는 것을 발견했다.

이러한 종류의 피드백 제어(제1 경로)는 두 가지 장점이 있는 것으로 알려져 있다. 첫째, 그것은 매우 정확하다. 단백질 합성 속도는 항상 세포가 이용할 수 있는 자원의 수준에 따라 설정된다. 둘째, 그것은 예측 가능 여부와 관계없이, 모든 변동에 대응하여 작동된다. 그러나 중요한 것은, 피드백 제어 모듈은 또한 한계가 있으며, 큰 외부적 변화에 대해 느리게 반응한다. 인공제어 시스템에는 종종 주요 입력신호에 대한 반응을 유도하는 피드포워드 제어 모듈이 포함된다. 그리고 다시 보다 정확한 피드백 컨트롤러 인계를 가능하게 하는 것이다. 이것이 바로 PKA 경로(제2 경로)의 기능이다.[1]

애리조나 대학교의 미카일라 메이스(Mikayla Mace)는 보도 자료에서, 카팔디 팀의 연구 결과를 요약하며 이렇게 말했다 : “세포는 그들의 환경에서 이용 가능한 자원에 대해 지속적으로 적응하고 있다. 그들은 세포가 영양소를 꾸준히 이용할 수 있을 때, TOR 경로는 세포가 적절한(일치하는) 속도로 함께 움직이도록 작동되는 것을 발견했다. 그러나 세포가 갑자기 특정 영양소를 풍부하게 얻게 되면, PKA 경로는 기어를 바꾸고, 생산물이 25배 증가하도록 한 후에, 자체적으로 꺼지고, 다시 훨씬 더 정확한 TOR 조절이 작동된다.” 메이스는 공학적 기본 원리를 강조하고 있었다. "화학 엔지니어들은 동일한 원리를 사용하여 온도를 엄격하게 조절한다."[3]

그러나 엔지니어들이 사용하는 것과 동일한 설계 원칙으로 작동되고 있는 효모 세포에서, 이러한 “제어 이론”의 기원을 설명할 때, 카팔디 팀은 합리적인 공학적 인과관계를 언급하고 있을까? 아니다. 그들은 그렇게 하지 않았다. 그 이유는 무엇일까? 우선 효모에서 공학적 인과관계를 지적설계로 기술한다면, 그 연구 결과는 Nature 지에 게재될 가능성이 없어진다. 그러나 이보다 더 중요한 것은, 연구자들의 사고가 자연을 인격화하는, 신화적인 진화론적 세계관으로 세뇌되어 있기 때문이다. 그들은 어떻게든 자연이 이러한 제어시스템을 진화시켰을 것이라고 믿고 있었다.[4] 메이스와의 인터뷰에서, 카팔디는 제2 경로는 “자연이 PKA를 추가시켰다”라고 주장함으로써, 자연을 의인화 하는 그의 생각을 드러내고 있었다.[3]

과학적 발견에 대한 진지한 논평을 덧붙이고 있는 애리조나 대학의 보도자료는, 자연을 의인화하는 신화적인 시나리오로 시작되고 있었다. 그들은 이 의인화라는 진화론적 도구를 사용하여, 공학적 원리가 왜 제어 이론과 생물학적 기능의 기초가 되는지를 설명하고 있었다. 보도자료는 이렇게 말한다 :

지난 150년 동안 엔지니어들은 제어 이론이라는 것을 사용하여, 느려짐(부족) 또는 과속(과다) 없이 동적 시스템을 안정화하는 방법을 개발하고 마스터해왔다. 이제 애리조나 대학 연구팀은 세포와 유기체가 제어이론의 원리를 따르는 복잡한 생화학적 회로를, 공학자들이 펜으로 도면에 그리기 수억 년 전에 이미 진화시켰음을 보여주었다.

보도 자료는 “제어 이론: 어머니 자연은 공학자(Control theory: Mother nature is an engineer)”는 제목을 통해, 자연이 어떻게든 의지력을 사용할 수 있다는 진화론적 맹신을 보여주고 있었다.

아이러니하게도, 우연히 무작위적 과정으로 생겨난 것과는 반대되어 보이는, 명백히 지적설계로 보이는 이러한 시스템에 대해서 카팔디는 이렇게 말하고 있었다. “우리 세포에는 30,000개의 단백질이 있으며, 생물학자들은 성장을 조절하는 수천 개의 단백질들 중 하나라도 잘못된다면, 질병에 걸릴 수 있음을 발견해왔다.” 그는 덧붙였다. “이 경로는 단순한 온/오프 스위치처럼 작동하지 않는다. 우리가 새로운 연구에서 보여준 것처럼, 이 경로들은 복잡한 회로, 심지어 컴퓨터처럼 작동되고 있었다.”[3] “수백 개의 신호들과 수백 개의 경로들이 서로 연결되어 있다”고 말하고 있기 때문에, 앞으로 과학자들은 새로운 사실들을 수없이 발견해낼 것 같다.

효모의 대사를 조절하는 제어 이론이 공학적 원칙에 의해 잘 설명된다는 사실은, 생물들은 설계되어 있다는 ICR을 비롯한 창조과학 단체들의 중심 가정을 다시 한 번 확인해주는 것이다. 카팔디의 연구 결과를 지적설계로 해석한다면, 생물체가 환경 문제를 신속하게 해결할 수 있는 공학적 메커니즘은 쉽게 이해될 수 있다. ICR은 이러한 경이로운 생물학적 시스템의 기원을 간단하게 설명할 수 있다. 그것은 설계되었기 때문에, 설계된 것처럼 보이는 것이다. 아마도 제어 이론과 그렇게 보이는 다른 시스템에 대한 연구들은 자연 만물의 창조주이신 주 예수 그리스도의 영원하신 능력과 신성을 실제적으로 보여주는 것일 수 있다.(롬 1:20).


References

1. Kunkel, J., X. Luo, and A. P., Capaldi, 2019. Integrated TORC1 and PKA signaling control the temporal activation of glucose-induced gene expression in yeast. Nature Communications. 10 (1): https://doi.org/10.1038/s41467-019-11540-y
2. Guliuzza, R. J. 2018. Engineered Adaptability: Adaptive Changes Are Purposeful, Not Random. Acts & Facts. 47 (6): 17-19.
3. Mace, M. Control theory: Mother nature is an engineer. Posted at uanews.arizona.edu on August 7, 2019, accessed September 1, 2019.
4. Guliuzza, R. 2011. Darwin’s Sacred Imposter: Natural Selection’s Idolatrous Trap. Acts & Facts. 40 (11): 12-15.
5. Guliuzza, R. J. 2018. Engineered Adaptability: Adaptive Solutions Are Targeted, Not Trial-and-Error. Acts & Facts. 47 (7): 17-19.

*Randy Guliuzza is ICR’s National Representative. He earned his M.D. from the University of Minnesota, his Master of Public Health from Harvard University, and served in the U.S. Air Force as 28th Bomb Wing Flight Surgeon and Chief of Aerospace Medicine. Dr. Guliuzza is also a registered Professional Engineer.



*참조 : 자료실/창조설계/생명체

http://creation.kr/LIfe


출처 : ICR, 2019. 10. 22.

주소 : https://www.icr.org/article/cells-and-designers-both-use-control-theory/

번역 : 미디어위원회

미디어위원회
2019-11-07

세포가 산소를 처리하는 놀라운 방법과 2019년 노벨 생리의학상

(How the Cell Handles Oxygen: A Nobel Prize Discovery.

Another Amazing Body Function Discovered – Cellular Oxygen Regulation)

by Henry L. Richter, PhD.


     2019년의 노벨 생리의학상은 3명의 연구자에게 수여되었다. 그들은 인체의 세포가 산소 농도를 자동적으로 조절하는 방법을 발견했다. 산소의 양은 항상 섬세한 균형이 유지되어야 한다. 너무 적으면 세포는 제대로 신진대사를 할 수 없고, 너무 많으면 과도하게 혹사되는 상태가 되기 때문이다. 최근 Chemical & Engineering News(C&EN, 2019. 10. 7)에 게재된 기사에서 그 수상에 대해서 다음과 같이 설명하고 있었다 :

.세포의 조절과 규제는 경이롭다. Credit: Illustra Media.

2019년 노벨 생리의학상은 세포생물학에서 패러다임 전환으로 묘사된, 산소의 역할에 관한 연구를 수행한 세 명의 연구자들에게 돌아갔다.

세포가 산소 부족을 감지하고 적응하는 방법을 발견한, 미국 하버드 대학 데이나-파버 암연구소의 윌리엄 케일린(William G. Kaelin Jr) 교수, 영국 옥스퍼드 대학과 프랜시스크릭 연구소의 피터 랫클리프(Peter J. Ratcliffe) 교수, 미국 존스홉킨스 의과대학의 그레그 서멘자(Gregg L. Semenza) 교수가 선정되었는데, 이들은 약 1백만 달러의 상금을 공동으로 받게 되었다. 

지구상의 대부분의 생명체들은 생존하기 위해서 산소를 대사하도록 진화했지만, 세포 내에 산소가 너무 많거나 적으면 치명적일 수 있다. 케일린, 랫클리프, 서멘자는 세포 내에서 산소 감지에 관여하는 단백질들과 이들이 상호 작용하는 방식을 확인했다. 그들의 연구는 발달생물학 및 암 연구와 같은 분야에 대한 통찰력을 제공하고, 암 치료제와 빈혈 치료제의 개발로 이어질 수 있다.


여기에서 생명체에 절대적으로 필수적인, 고도로 복잡한 신체 기능의 또 다른 예가 언급되고 있는 것이다. 이 과정이 어느 시점까지는 존재하지 않았던 것처럼, “지구상의 생명체들이 진화시켰다...”라고 이 기사가 설명하는 것은 우스꽝스럽다. 진화의 무작위 과정을 통해서 생명체가 그 과정을 진화시켰다면, 그 이전에는 어떻게 살아남을 수 있었는가?

C&EN 기사는 그들이 이해한 것처럼 그 메커니즘을 이렇게 설명하고 있었다 :

세 연구자의 발견은 저산소증 유발인자(hypoxia-inducible factor, HIF)라고 불리는 한 전사인자(transcription factor)의 작용을 중심으로 이루어진다. 정상적인 산소 조건 하에서, 세포 효소는 HIF-1α 라 불리는 HIF의 성분을 하이드록실화하여, 또 다른 단백질인 VHL에 의해 인식될 수 있게 한다. VHL이 HIF-1α에 결합할 때, 그것은 전사인자를 단백질을 처리하는 세포기계에 의해서 파괴되도록 표시한다. 그러나 세포의 산소 농도가 낮거나, 일부 질병 상태에서는 HIF-1α가 파괴로 표시되지 않아, 저산소 반응에 관여하는 유전자의 스위치를 켤 수 있다.

산소 감지는 세포가 저산소 또는 고산소 조건에 적응하여 신진대사를 할 수 있도록 해주며, 이는 세포 건강에 매우 중요하다고 포시스(Forsyth)는 설명한다. 많은 생리 기능들이 이 과정을 통해 미세하게 조정되며, 산소 감지가 질병 치료의 핵심이다. 예를 들어, Torisel과 Zortress는 HIF를 표적으로 하여, 신체의 종양에 영양분을 공급하는 혈관의 수를 줄이려고 시도하고 있다.

세포가 건강할 수 있도록 해주는데 반드시 필요한 신체 기능들이 너무도 많다. 또 하나 염두에 두어야 할 것은 신체의 온도 조절이다. 우리는 건강을 의미하는 “37℃”에 익숙하다. 체온은 세포가 정확한 속도로 영양분을 대사하여 세포를 적절히 따뜻하고 건강하게 유지함으로써 생성된다. 세포에서 체온을 측정하는 것은 무엇이며, 정확한 방식으로 열 생성을 조절하는 것은 무엇인가? 그것은 정말로 매우 정확하게 일어나고 있다!

-------------------------------------------------- ------


사람의 몸은 심히 기묘하고 기이하게 만들어졌다. “내가 주께 감사하옴은 나를 지으심이 심히 기묘하심이라 주께서 하시는 일이 기이함을 내 영혼이 잘 아나이다”(시편 139:14). 이러한 경이롭도록 복잡하고 정교한 기능이 무작위인 과정으로 우연히 생겨났을 것이라는 주장은 관측 사실을 무시하는 강력한 편견에 의한 매우 불합리한 주장인 것이다.



*관련기사 : 노벨 생리의학상, 美케일린 등 3명…“세포의 산소이용 연구” (2019. 10. 7. 문화일보)

http://www.munhwa.com/news/view.html?no=20191007MW184050852279

노벨생리의학상 과학자들, 산소에 적응하는 세포 신비 밝혀 암치료 길 열다(2019. 10. 7. 동아사이언스)

http://dongascience.donga.com/news.php?idx=31606


출처 : CEH, 2019. 11. 2.

주소 : https://crev.info/2019/11/how-the-cell-handles-oxygen/

번역 : 미디어위원회

미디어위원회
2019-10-01

바이러스에 감염된 박테리아가 보여주는 창조의 복잡성.

(Virus-Infecting Bacteria Reveal Creation Sophistication)

by Frank Sherwin, M.A.  


     바이러스(virus)가 작은 감염원이라는 것은 잘 알려져 있다. 그들은 강제로 세포내로 들어가서 분자기계들을 정복한다. 감염된 세포는 바이러스 DNA로 인해, 정상적으로 세포의 부분들을 만드는 것을 멈추고, 대신에 전사 및 복제에 의해 더 많은 바이러스를 만들도록 지시받는다. 점점 더 많은 바이러스성 부품들이 제조됨에 따라, 세포는 분해라는 과정으로 세포벽이 파열된다. 그런 다음 새로 만들어진 바이러스들이 방출되어 다른 세포를 감염시킨다.

바이러스는 사람, 식물 및 동물을 감염시킨다. 그리고 작은 박테리아를 감염시키는 바이러스도 있다. 이것을 박테리오파지(bacteriophages) 또는 간단히 파지(phages)라고 불린다. 파지들은 박테리아의 세포벽을 통해 세포질 내로 유전물질(게놈)을 주입한 후, 박테리아 내에서 파지가 복제(복사)되게 한다. 박테리오파지는 24시간 바다에 있는 대부분의 박테리아를 주기적으로 용해시켜, 바다가 건강해지도록 만드는 데에 기여한다. 이러한 설계된 과정은 해양 먹이사슬에서 탄소 순환처럼, 박테리아 개체군의 폭발을 방지하는 데 도움이 된다.[1]

21세기에 들어와서 박테리아(핵이 없는 유기체)의 복잡성은 잘 알려지게 되었다.[2] 이제 2019년에 연구자들은 말했다 : “장시간 저속촬영 형광 현미경법(time-lapse fluorescence microscopy) 및 초저온 전자현미경 단층촬영(cryo-electron tomography)과 같은 새로운 기술을 통해, 박테리아 내부의 놀라운 구조들과 그들의 매우 정교하고 복잡한 조직 원리들을 모두 살펴볼 수 있게 되었다.“[3]

연구자들은 무엇을 발견했는가? 캘리포니아, 샌디에고 대학의 연구자들은 “우리의 세포 내에서 발생하는 것과 유사한 과정으로, 런닝머신(treadmill)과 같은 구조를 따라 박테리아 세포 내에서 화물이 이동되고 있는 최초의 사례를 제공했다.”[3] 박테리아와 인간 세포 사이에는 상당한 차이가 있지만, 놀랍게도 "파지는 감염된 (박테리아) 세포 중심부에, 복제된 파지 DNA를 둘러싸는 일종의 단백질 껍질로 형성된, 핵과 유사한 구조가 있는 포유류 유형의 세포로 전환시킨다."[3]

샌디에고 대학의 보라폰(Vorrapon Chaikeeratisak)은 말했다 : “박테리아 내에서 이 거대한 파지(슈도모나스 파지, Pseudomonas phage)가 복제되는 방식은 매우 흥미롭다.” "박테리아 숙주 세포를 접수하는데 사용되는 메커니즘에 대한 많은 질문들이 생겨난다." 모든 미생물 연구와 마찬가지로, 이 특별한 조사는 "박테리아 세포 내에서 수송 및 분포 메커니즘에 대한 새로운 질문을 불러일으킨다.”[3]

진화론자들은 말한다 : “이들 파지는 숙주 내에서 복제되기 위해서, 필라멘트를 사용하는 복잡하고 지시된 운송 메커니즘을 진화시켰다.”[3] 그러나 창조론자들은 말한다 : “이들 파지는 숙주 내에서 복제되기 위해서 필라멘트를 사용하는 복잡하고 지시된 운송 메커니즘을 갖도록 설계되었다”. 진화론자들은 오랜 시간과 우연이 그것을 만들었다는 것이고, 창조론자들은 창조주가 계획과 목적을 갖고 만드셨다는 것이다.



References 

1. Suttle, C. A. 2005. Viruses in the sea. Nature. 437 (7057): 356–61.

2. Sherwin, F. 2001.Just How Simple Are Bacteria? Acts & Facts. 30 (2).

3. Viruses found to use intricate ‘treadmill’ to move cargo across bacterial cells. ScienceDaily. Posted on ScienceDaily.com June 13, 2019, accessed June 23, 2019; Sherwin, F. 2004. Molecular Motors vs. Evolutionism. Acts & Facts. 33 (4).

*Mr. Sherwin is Research Associate is at ICR. He earned his master’s in zoology from the University of Northern Colorado. 


*참조 : 춤을 추고 있는 세포의 소기관들 : 세포의 초고도 복잡성이 계속 밝혀지고 있다.

http://www.kacr.or.kr/library/print.asp?no=7029


놀랍고, 독특하고, 진정 기괴한 옐로스톤의 미생물 

http://www.kacr.or.kr/library/print.asp?no=7023


플랑크톤은 그렇게 단순한 생물이 아니다. 

http://www.creation.or.kr/library/print.asp?no=6960


동물성 플랑크톤에서 발견된 다연발의 작살! : 하등하다는 원생동물에서 고도로 복잡한 기관의 발견 

http://www.kacr.or.kr/library/itemview.asp?no=6593


미생물도 의사소통을 하고 있었다! 

http://www.kacr.or.kr/library/itemview.asp?no=6619


토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. 

http://www.kacr.or.kr/library/print.asp?no=6373


박테리아의 놀라운 빛 감지 능력 : 렌즈와 같은 세포 

http://www.kacr.or.kr/library/print.asp?no=6327


세포의 미토콘드리아 세망은 도시 전력망을 닮았다. 

http://www.kacr.or.kr/library/itemview.asp?no=6216


바이러스는 바다를 좋게 만들 수 있다. 

http://www.kacr.or.kr/library/itemview.asp?no=6038


단순한(?) 아메바가 박테리아를 사육하고 있었다. 

http://www.kacr.or.kr/library/print.asp?no=5136


점균류의 네트워크는 철도 시스템을 능가하고 있었다. 

http://www.kacr.or.kr/library/print.asp?no=4834



출처 : ICR, 2019. 7. 23.

주소 : https://www.icr.org/article/virus-infecting-bacteria-creation-sophistication/

번역 : 미디어위원회

미디어위원회
2019-08-30

광합성은 처음부터 설계되어 있었다.

(Photosynthesis: Clearly Designed from the Beginning)

Frank Sherwin 


     희귀한 박테리아의 독특한 구조는 경이로운 광합성(photosynthesis) 과정이 진화론자들이 생각하는 것보다 훨씬 “더 오래되었음”을 가리키고 있었다.


광합성은 햇빛, 물, 이산화탄소를 당(sugar)과 산소로 바꾸는 과정이다. 여기에는 두 가지 유형이 있다. 첫 번째는 물이 아닌 다른 분자를 사용하여, 부산물로 산소를 생성하지 않는 무산소성 광합성(anoxygenic photosynthesis)이다. 두 번째는 산소성 광합성(oxygenic photosynthesis)으로, 물을 수소와 산소로 분리하여 광합성을 유도하고, 부산물로 산소를 방출한다. 산소성 광합성은 가장 흔하며 조류, 식물, 일부 박테리아에서 발견되며, 사람과 동물의 삶을 유지하는 하나의 기본 과정이다.


수십 년 동안 진화론은 무산소성 광합성이 약 35억 년 전에 먼저 진화했으며, 약 10억 년 뒤에 산소성 광합성이 진화되었다고 주장해왔었다. 그러나 ScienceDaily(2019. 7. 25) 지의 보도에 의하면, 런던의 임페리얼 칼리지(Imperial College)의 타나이 카도나(Tanai Cardona) 박사와 연구자들은 소위 “고대” 박테리아(Heliobacterium modesticaldum)의 독특한 구조를 발견했는데, 산소 광합성이 전통적인 생각보다 10억 년 더 일찍 발생했다는 것이다.[1]


창조론자들은 광합성을 매우 정교한 생화학적 과정으로, 오랜 시간 동안에 우연히 저절로 생겨날 수 없다고 믿고 있다.[2, 3] ScienceDaily 지의 기사는 언급했다 : “그 발견은 전통적으로 생각하고 있던 광합성의 진화를 다시 생각할 필요가 있음을 의미한다.”[1] 특히 몇 달 전에 타나이가 한탄했던 것을 고려하면, 그 말은 사실이다. 


20세기 전반에 시작된 광합성의 진화에 대한 추론적 논쟁은 끊임없이 계속되어 왔다. 이러한 추론적 아이디어 중 일부는 일반화되었고, 사실로 받아들여졌지만, 거의 지지를 받지 못했다.[4]


임페리얼 대학의 연구팀은 고대 박테리아인 헬리오박테리움 모데스티칼둠(H. modeticaldum)을 조사함으로써, 완전한 기능적인 광합성이 이미 존재했다는 것을 발견했다. 간단히 말해서, 한 종류의 광합성은 다른 것으로 진화되지 않았다는 것이다.


진화론자들은 빛에너지를 당으로 변환시키는 경이롭도록 복잡한 과정이 간단하게 진화되었다고 말한다. 그들은 이 생각을 다시 생각할 필요가 있다. 그리고 광합성에 관한 전통적인 진화론적 생각은 이제 잘못되었음이 밝혀졌다. 



References 

1.Strange bacteria hint at ancient origin of photosynthesis.ScienceDaily. Posted on ScienceDaily.com July 25, 2019, accessed August 2, 2019.

2. Sherwin, F. 2019.Photosynthesis Continues to Amaze. Creation Science Update. Posted on ICR.org March 14, 2019.

3. Thomas, B. 2012. Photosynthesis Uses Quantum Physics.Creation Science Update. Posted on ICR.org June 25, 2012.

4. Cardona, T. 2019. Thinking twice about the evolution of photosynthesis. Open Biology. Published on royalsocietypublishing.org March 20, 2019.

*Mr. Sherwin is Research Associate is at ICR and earned a master’s in zoology from the University of Northern Colorado.



*참조 : 광합성은 생각보다 10억 년은 앞서서 37억 년 전에 이미 시작되었다? 

http://www.creation.or.kr/library/itemview.asp?no=1553


식물의 광합성은 양자물리학을 이용하고 있었다. 

http://www.creation.or.kr/library/itemview.asp?no=5432



출처 : ICR, 2019. 8. 13.

주소 : https://www.icr.org/article/photosynthesis-clearly-designed-from-beginning/

번역 : 미디어위원회














미디어위원회
2019-08-29

DNA 손상 연구는 놀라운 복잡성을 드러냈다.

(DNA Repair Research Reveals Astounding Complexity)

 Frank Sherwin  


      당신은 수십조 개의 세포들로 설계되어있다. 각 세포의 핵 안에는(적혈구 제외) DNA라고 불리는 “생명의 분자”가 있다. 그것들은 수천 개의 유전자들로 이루어진 염색체(사람은 46 개) 내에 조직화되어 있다. 유전자는 T, G, C, A라고 불리는 수많은 뉴클레오티드 염기들로 구성된 유전적 단위이다. 각 세포는 복잡한 대사 과정, 또는 물질대사(metabolism)를 수행한다. 우리는 타락한 세상에서 살고 있기 때문에, 때때로 이러한 과정(예로 산소 대사)은 유해한 DNA 손상을 유발할 수 있는 반응성 화학물질을 생성할 수 있다. 또한 DNA는 환경적 독성물질들과 전리방사선에 의해서 손상될 수 있다.


온혈 포유동물의 각 세포에서 이러한 자연적 변경, 또는 손상은 하루에 약 10,000개의 염기를 잃어버리는 것으로 추정되고 있다! 이러한 손상들을 수선하지 못하면, DNA에서 영구적인 변경, 또는 돌연변이가 발생한다.[1]


어떤 의미에서 우리의 건강은 주로 세포의 DNA 손상에 대한 반응(DDR)에 달려 있다. 하나님께서는 우리 몸이 분자 수준에서 유전자 독성 스트레스라 불리는 환경 및 대사 손상에 반응하도록 설계하셨다. 과학자들은 DNA를 손상되지 않은 상태로 유지하는 다수의 수선(복구) 메커니즘들을 발견했다. 가장 일반적인 메커니즘 중 세 가지는 DSB(double-strand breakage repair, 양가닥절단 수선), MMR (mismatch repair, 불일치 복구), BER(base-excision repair, 염기 절단 복구)이다.


그러나 이처럼 복잡한 과정들에는 MRE11–RAD50–NBS1이라 불리는 일련의 작은 단백질들이 관여한다. 이들은 함께 모여서 MRN 복합체(MRN complex)라 불리는 다기능 DDR 분자기계를 구성한다.[3] 기본적으로 MRN은 DNA 나선 구조에 결합하도록 설계되어 있으며, DNA 손상의 감지기로 작동한다.[4] 연구자(Syed and Tainer)들은 이 MRN 복합체를 “흥미로운 화학-기계적 분자기계”라 부르고 있었다. 그리고 그것의 다중도메인 3 단백질(MRE11–RAD50–NBS1) 구성은 손상 반응에 대한 중앙 효소, 감지, 신호, 건설, 비계설치(scaffolding)를 가능하게 한다는 것이다.[3]


세속적 과학은 이러한 놀라운 수선 시스템(MRN 복합체와 같은)이 어떻게 우연히 저절로 생겨날 수 있었는지를 설명하기 어렵다. 아이러니하게도 DNA는 손상되기 쉬운 분자이다. 진화론자들은 수십억 년 전에 DNA(또는 RNA)가 무기물로부터 우연히 생겨났을 것으로 추정하고 있다. 그렇다면 다음과 같은 질문이 예상될 수 있다 : DNA 분자의 손상을 수선하고 안정적으로 유지시키는 복구시스템은 어떻게 생겨나게 되었는가? 그리고 그러한 분자기계들을 만들기 위한 암호들은 어떻게 생겨나게 되었는가? 이것도 우연히 같이 만들어졌는가? 논리적으로 암호는 스스로 만들어질 수 없다는 것이다. 이것은 특별히 고도로 복잡한 DNA 암호와 관련이 있다.[7]


마지막으로, MRN 촉매 서브복합체는 모든 생물들에서 보존되어 있다는 것이다.[3] 즉, 그것은 진화되지 않았다. 두 진화론자는 “DNA와 단백질 염기서열, 그리고 어떤 구조들은 장구한 지질학적 시간에 걸쳐 비교적 변하지 않은 채로 남아있다”고 말했다.[8]


변하지 않았다는 것에 창조과학자들은 동의한다. 경이롭고 복잡한 MRN 복합체는 수천 년 전에 처음부터 완벽하게 기능하도록 창조되었으며, 그때 이후로 DNA는 수선되어왔다.



References 

1. Karp, G. 2013. Cell and Molecular Biology, 7th edition. New York: Wiley Publishers. 565.

2. Sherwin, F. 2018. DNA Paramedics Repair Chromosomes. Creation Science Update. Posted on ICR.org July 24, 2109, accessed August 14, 2019.

3. Syed, A. and J. A. Tainer. 2018. The MRE11–RAD50–NBS1 Complex Conducts the Orchestration of Damage Signaling and Outcomes to Stress in DNA Replication and Repair. Annual Review of Biochemistry. 87: 263-294.

4. Lavin, M. 2007. ATM and the Mre11 complex combine to recognize and signal DNA double-strand breaks. Oncogene. 26(56): 7749-58.

5. Bernhardt, H. S. 2012. The RNA world hypothesis: the worst theory of the early evolution of life (except for all the others). Biology Direct. 7:23.

6. Wills, P. R. and C. W. Carter. 2018. Insuperable problems of the genetic code initially emerging in an RNA world. Biosystems. 164: 155-66.

7. Tomkins, J. 2015. Three-Dimensional DNA Code Defies Evolution. Creation Science Update. Posted on ICR.org April 27, 2015, accessed August 14, 2019.

8. Thain, M. and M. Hickman. 2004. The Penguin Dictionary of Biology. London, UK: Penguin Books, 172. Article posted on August 15, 2019.

*Mr. Sherwin is Research Associate is at ICR. He earned his master’s in zoology from the University of Northern Colorado.



*참조 : DNA 수선은 팀웍을 필요로 한다 : DNA 사슬간 교차결합의 수선에 13개의 단백질들이 관여한다.

http://www.kacr.or.kr/library/itemview.asp?no=4806

DNA 수선 기작의 놀라운 조화 

http://www.kacr.or.kr/library/itemview.asp?no=4011

2015년 노벨 화학상으로 부각된 세포의 DNA 손상 복구 메커니즘은 진화론을 거부한다.

http://www.kacr.or.kr/library/itemview.asp?no=6274

DNA 복구 효소에서 발견된 극도의 정밀성 

http://www.kacr.or.kr/library/itemview.asp?no=3275


출처 : ICR, 2019. 8. 15.

주소 : https://www.icr.org/article/dna-repair-research-astounding-complexity/

번역 : 미디어위원회

미디어위원회
2019-08-26

 DNA의 이중 나선을 푸는 모터, 국소이성화효소

: ‘한 요소도 제거 불가능한 복잡성(환원 불가능한 복잡성)’의 한 사례

(God’s DNA-detangling motors: The topoisomerase enzymes)

Jonathan Sarfati 


   모든 생명체들은 믿을 수 없을 만큼 놀라운 분자기계들과 그것을 만들 수 있는 ‘지침 설명서’를 갖고 있다. 안내 책자에는 기계를 작동하는 방법에 관한 정보가 문자로 쓰여 있다. 마찬가지로 생명체 내의 지침 설명서는 DNA 분자에 화학적 암호 ‘문자’(뉴클레오티드의 순서)로 쓰여져 있다.

더욱이, 이 지침 설명서는 다음 세대로 복사가 된다. 당신은 어머니의 눈과 아버지의 귀를 직접 받은 것이 아니다. DNA에 복사된, 어머니의 눈과 아버지의 귀를 제조하는 지침서를 물려받은 것이다.(아래의 부록 참조).

가장 단순한 생명체라도 기능을 하려면, DNA의 물리적 크기로 인해 해결되어야 할 많은 문제들을 갖고 있다. DNA의 이중 나선 구조는 그 폭이 약 2.5나노미터(1천만 분의 1인치)로, 너무 얇아서 어떤 광학현미경으로도 볼 수 없다. 그러나 전체 DNA 분자는 극도로 길다. 사람의 가장 큰 1번 염색체는 2억2천만 글자로 구성되어 있으며, 전부 펼치면 길이가 85mm(3.4인치)가 된다. 당신 세포 안에 있는 모든 DNA를 한 줄로 연결하면, 길이가 약 2m가 된다! 엄청나게 길고, 극도로 얇으며, 끈적끈적한 가닥이 미세한 세포 네에 채워져 있어야 하기 때문에, 엉키거나, 매듭이 생기지 않고, 유지되어야 한다. 세포는 이 모든 일을 수행하기 위해 복잡한 분자기계들이 필요하다. 이 기계들은 놀랍도록 복잡하며, 우리 창조주 하나님의 전지하심에 대한 증거가 되고 있다.


이중 나선을 풀기

DNA가 해독될 때(즉, 단백질 정보가 사용될 때), 이중 나선의 두 가닥이 분리되어야 한다. 그리고 재생산되는 동안, 각 가닥은 독립적으로 복사된다.

여기에는 DNA 헬리카제(DNA helicases)라 불리는 특수 모터가 필요하다. 그것들은 DNA가 통과할 수 있는 구멍이 있는 링 모양이다. 그러나 모터이기 때문에 역시 연료가 필요하다. 헬리카제는 ATP라고 불리는 ‘연료’에 의해 구동되는데, ATP는 또 다른 모터인 ATP 신타아제(ATP-synthase)에 의해 만들어진다.[1] 에너지원으로 ATP를 사용하면서, 모양은 주기적으로 변화하고, 약 10,000 rpm의 속도로 헬리카제 링 주위를 달리는데, 이 속도는 제트 엔진 터빈이 회전하는 속도이다. 헬리카제는 DNA를 따라 빠르게 달리며, 복제 갈래(replication fork)에서 두 가닥을 분리한다.[2] 그런 다음, 많은 다른 분자기계들이 DNA를 해독하고, 가닥을 다시 모으거나, 가닥을 복사한다. 이것은 DNA 복사 속도가 초당 1,000자이고 헬리카제가 복사기보다 앞서야하기 때문에, 매우 빠르게 실행되어야 한다.


과도한 꼬여짐

DNA의 나선형(뚤뚤 말린) 모양은 헬리카제가 그것을 풀어서 가닥을 분리할 때, 늘어나는 또 다른 문제를 일으킨다. 여러분은 여러 가닥으로 꼬여진 긴 밧줄로, 그 문제를 쉽게 시연해볼 수 있다. 가운데서부터 시작하여 가닥을 양쪽으로 당겨보라. 곧 분리점의 양쪽에 또 다른 비틀림 저항이 생겨서, 풀기가 매우 어려워질 것이다. 다시 놓으면, 밧줄은 원래 모양으로 다시 감기려고 할 것이다. 오래된 유선 전화기의 감겨진 전화줄을 생각해보라. 전화줄은 꼬인데 위에 또 꼬여지면서 쉽게 얽히는 것을 알 수 있다. 앞 방향으로 꼬임이 일어나는 것을 보완하려면, 풀리는 위치 뒤쪽의 DNA에 꼬임을 추가시키고, 또한 슈퍼 코일(많이 감김)이 되어야 한다. 세포에서 DNA의 풀림이 방해되면, 세포는 더 이상 단백질을 만들지 못하거나, 스스로를 복제할 수 없다.

(그림) DNA 복제 또는 DNA 합성은 이중 가닥의 DNA 분자를 복제하는 과정이다. 이 과정은 우리가 알고 있는 한 모든 생명체들에서 가장 중요하다. 이것은 매우 복잡한 기계류에 대한 간단한 도표이다(예를 들면, 헬리카제는 DNA 가닥이 통과하는 고리 구조를 갖고 있다).


DNA의 이중나선을 푸는 분자기계

창조주께서는 살아있는 생명체 내의 이러한 문제를 국소이성화효소(topoisomerases)라 불리는 특별한 단백질 기계(효소)를 가지고 해결하셨다.[3] 국소이성화효소는 DNA를 자르고, 다시 배열하고, 다시 붙인다. 국소이성화효소는 DNA가 과도하게 감겨지는 것을 방지하기 위하여, 복제 갈래(replication fork)의 앞에서 작동되고 있다.

국소이성화효소에는 몇 가지 부류가 있지만, 2개의 주요 유형으로 분류된다 :

•TypeⅠ 국소이성화효소는 DNA 가닥 중 하나를 절단하고, 일시적으로 절단된 양끝에 접착된다. 그런 다음 절단되지 않은 가닥은 갈라진 틈으로 자유롭게 통과된다. 어느 경우이든, 이것은 한 번에 하나의 꼬임씩 변형을 해제하거나 ‘이완’시킨다. 마지막으로 절단된 틈을 다시 연결하는데, 이것을 결찰(ligation)이라고 한다.

유형 1의 국소이성화효소는 ATP를 필요로 하지 않는다. DNA의 과다 감김에 의해 축적된 에너지는 감겨진 스프링을 내버려 둘 때 그러하듯이, 단순하게 방출된다.

•Type II 국소이성화효소는 더 복잡하다. 이 유형은 이중 나선의 두 가닥을 다 자르고 그것을 따로 붙들고 있다. 그런 다음 절단되지 않은 부분에서 이중 나선의 루프를 갈라진 틈을 통하여 당겨온다. 그 후, 두 가닥이 재연결되고, 통과된 DNA가 방출되며, 마지막으로 효소가 재연결된 DNA를 방출하므로서, 그 과정을 필요한 대로 반복할 수 있다. 이 여러 단계에서 ATP가 필요하다.

유형 II의 국소이성화효소는 또 다른 이유 때문에 중요하다 : DNA가 복제될 때, 간혹 두 개의 ‘딸’ DNA 분자가 사슬의 고리처럼 서로를 감쌀 수 있다. 즉, 사슬 꼴로 연결될(catenated) 수 있다(라틴어 catena = 사슬). 따라서 이러한 연결된 분자들을 분리하는 것을 decatenation(분리)라고 하며, 이것이 유형 II의 국소이성화효소의 중요한 역할이다.


완전히 기능하지 않으면 쓸모없다.

이들 효소는 세 가지 일을 해야 하는데, 그렇지 않으면 전혀 쓸모없거나, 심지어 해로울 것이다: (1)절단, (2)절단된 곳을 통하여 다른 가닥을 이동시키기, (3)다시 연결하기. 각 단계가 얼마나 중요한지는, 어떤 한 단계라도 무능하게 되면, 그 효소는 작동하지 않고, 그 세포는 죽는다는 것이다.

사실 일부 항균제와 항암제는 국소이성화효소를 표적으로 삼고 있다. 플루오로퀴놀론계(fluoroquinolones, 예로 시프로플록사신(ciprofloxacin), 레보플록사신(levofloxacin))라고 불리는 항생제들은 세균성 유형 II 국소이성화효소의 재연결 단계를 멈추게 하여, DNA 속에 갈라진 틈을 증가시켜 세포를 빠르게 죽인다. 일부 항암제(예를 들어, 캠토테신(camptothecin), 토포테칸(topotecan))들은 통제되지 않고 재생되는 암세포에서, 유형 I과 유형 II의 국소이성화효소에 동일한 작용을 가한다.

촉매 억제제(catalytic inhibitors)라고 부르는 다른 부류의 약물은 ATP 에너지 방출을 막아서, 첫 번째 단계인 절단을 중단시킴으로써 작용을 한다. DNA가 조각으로 찢어져서 세포가 죽는 대신에, DNA가 엉키게 해서, 세포가 단백질들을 만들지 못하게 하여 세포의 번식을 억제한다.


진화론이 갖게 되는 문제

분명히 생명체 이전의 조건에서, 작고 점진적인 단계의 무작위적 화학반응들에 의해서, 첫 번째 세포를 만들어낼 수 없었다. 각각의 단계는 이전의 단계보다 더 나은 점이 있어야 하고, 자연선택이 이것을 선호해야 하는데, 이 과정에서 효소가 첫 번째 단계인 절단을 실행했다고 가정해 보자. 그것을 다시 모으지 않는다면, 이것은 정보 분자를 조각으로 절단하여 세포에 해를 입힐 것이다!

그러나 그것은 심지어 진화에 더 나쁘게 작용한다. 자연선택은 정의에 의하면 차등 번식(differential reproduction)이다 : 즉, ‘A가 B보다 더 적합하다’라는 말의 의미는 ‘A가 B보다 생존하는 후손이 더 많음’을 의미한다. 따라서 자연선택에는 최소한 두 개의 복제된 개체가 필요하다. 그래야 선택을 할 것이 아닌가? 이것은 DNA를 복제하는 방법을 갖기 전까지는 번식할 수 없기 때문에, 복제의 기원을 설명할 수 없다는 것을 의미한다. 그리고 우리가 보았듯이 국소이성화효소 없이는 DNA가 너무 빨리 엉키게 될 것이기 때문에, DNA를 복제할 수 없다. 자연선택은 첫 번째 국소이성화효소의 기원을 설명할 수 없으므로, 다윈의 진화론은 시작조차 하지 못하는 것이다.[4]

여전히 존재하는 또 다른 문제는 ‘닭이 먼저냐 달걀이 먼저냐’ 문제이다.[5] 즉, 국소이성화효소를 만드는 지침(정보)은 DNA에 들어있다. 그러나 DNA를 푸는 국소이성화효소가 없으면, 이들 지침을 읽을 수 없다. 심지어 가장 간단한 유형 II 국소이성화효소도 두 개의 분절 사이에 800개의 ‘아미노산 암호’가 들어있다. 하나의 단백질을 암호화하는 데에는 3개의 DNA ‘철자’가 필요하기 때문에, 이를 위한 유전자는 길이가 약 2,400개의 철자이므로, 너무 길어서, 풀지 않고는 읽을 수 없다.

그리고 이 모든 지침들은 딸 DNA 가닥을 분리하는 유형 II 국소이성화효소가 없으면, 다음 세대로 넘어갈 수 없다. 살아있는 모든 생명체 중 가장 작은 유전체를 갖고 있는 마이코플라즈마 제니탈리움(Mycoplasma genitalium, 바이러스와 세균의 중간 성질을 지닌 미생물)의 DNA조차도 너무 커서 스스로 분리될 수는 없다.


결론

가장 단순한 생명체조차도 단백질을 만들거나 그것들을 자손에게 전달해 주기 위해서는, DNA 지침서를 읽을 수 있기 이전에, 국소이성화효소가 필요하다. 이들은 복잡하고 잘 설계된 분자기계로서, DNA를 절단하고, 이동시키고, 다시 연결한다. 그것들 없이는 재생산이 불가능하기 때문에, 무작위 돌연변이와 자연선택의 결합이라는 다윈의 진화로는 최초의 국소이성화효소를 만들어 낼 수 없다.


--------------------------------------------------

(부록) DNA : 최고의 정보저장 시스템


DNA는 이 우주에서 가장 발달된 정보의 저장/검색/전송 시스템이다. 살아있는 세포의 DNA 정보 밀도는 약 1,000 테라바이트/입방 밀리미터이다.[1] 따라서 살아있는 세포는 아주 작은 공간에 엄청난 양의 정보를 저장할 수 있다. 가장 단순한 생명체인 마이코플라즈마는 세포 내 기생체로 약 600킬로바이트의 DNA를 가지고 있는 반면, 인간 세포 하나에는 약 3기가바이트를 갖고 있다.[2]


각각의 인간 세포에 들어있는 모든 정보를 종이와 잉크로 쓴다면, 성경 약 1,000권에 해당하는 막대한 량이다.[3] 그러나 잉크의 화학 성분에는 책의 정보를 생성할 수 있는 것이 아무 것도 없다. 종이에 잉크를 쏟아 부을 때, 정보가 생산되지 않는다! 정보는 저자가 잉크로 문자를 배열함으로써 생성된다. 정확히 동일한 방식으로, DNA의 ‘문자’를 이루는 화학성분에는 생명체의 메시지를 쓰게 하는 어떠한 것도 들어 있지 않다.


1. More details and documentation in Sarfati, J., DNA: the best information storage system, 9 October 2015; creation.com/dna-best. See also Batten, D., DNA repair mechanisms ‘shout’ creation, Creation  38(2):56, 2016; creation.com/dna-repair.

2.For simplicity, I treat each DNA ‘letter’ as a ‘byte’ of information, which is ‘in the right ball park’. In reality, since there are four possibilities at each locus, we could use two bits to store each letter, which would reduce the overall memory requirement by 4-fold. But, using one letter per byte, we have 3.17 billion base pairs (bp), and two copies of the genome in each cell, so 6.34 billion bp, or 5.90 GB.

3. Erb, K.E., [American] Tax code hits nearly 4 million words, Taxpayer Advocate calls it too complicated, forbes.com, 10 January 2013. For comparison, the KJV has almost 800,000 words. 

-----------------------------------------------


References and notes

1. Thomas, B., ATP synthase: majestic molecular machine made by a mastermind, Creation  31(4):21–23, 2009; creation.com/atp-synthase.

2. A good description and video can be found in Unwinding the double helix: Meet DNA helicase, evolutionnews.org, 20 February 2013. Other fascinating videos can be found on DNA Learning Center, dnalc.org.

3. For more information, see DeWeese, J.E., DNA topoisomerases—the ‘relaxers’ and ‘unknotters’ of the genome, J. Creation 30(2):92–101, 2016. Dr Joe DeWeese of Lipscomb University, Nashville, Tennessee, has published many topoisomerase papers in leading secular science journals. See also the video Topoisomerase 1 and 2, youtube.com.

4. The proposed origin of life from non-living chemicals is commonly called chemical evolution.

5. The answer’s actually easy according to Scripture: God created the chicken on Day 5, which then laid the egg. Actually, to be precise, God made the galliform created kind that comprises heavy ground-living birds, which after the Ark diversified into chickens, partridges, pheasants, quail, turkeys, etc. Lightner, J., An initial estimate of avian ark kinds, Answers Research Journal 6:409–466, 2013.


*참조 : 4차원으로 작동되고 있는 사람 유전체 : 유전체의 슈퍼-초고도 복잡성은 자연주의적 설명을 거부한다. 

http://www.creation.or.kr/library/print.asp?no=6468



출처 : Creation Magazine Vol. 40(2018), No. 1 pp. 24-26

번역 : 이종헌

주소 : https://creation.com/dna-detangling-motors-topoisomerase


단순한 생명체에서 고도의 복잡성이 발견되었다. 

: 하등한 해파리가 사람과 흡사한 눈을 가졌다? 

(More Complexity in Simplicity Found)


      2011. 4. 28 - 원시적 생명체란 없다. 단순한 생명체에서 고도의 복잡성이 발견되는 최근의 몇 가지 이야기들은 이제 진부한 이야기가 되는 것 같다.

1. 상자해파리의 눈 : 해파리는 가장 단순한 동물에 속한다. 그런데 왜 상자해파리(box jellyfish)는 뇌(brain)도 없이 24개나 되는 눈들을 가지고 있을까? 이제 이러한 눈들의 일부는 물 위에 있는 물체를 탐지하기 위한 것으로 밝혀졌는데, 그것은 해파리가 망그로브(mangrove) 서식지에서 머물 수 있도록 해준다는 것이다. (New Scientist, Live Science, PhysOrg을 보라).

어떻게 중추신경계(central nervous system)도 없는 해파리 같은 동물이 눈으로 들어오는 신호를 받아들이고, 협동적인 움직임으로 반응하는지 불가해한 일이다. New Scientist 지에서 한 해양학자는 ”우리는 단순한 생물체에 있는 감각계가 어떻게 상당히 복잡한 생물 적응(adaptation)에 사용되었는지에 대해 잘 알지 못하고 있다”고 말했다. 또 다른 연구자도 Live Science에서, ”이러한 사실은 해파리와 같은 단순한 동물의 행동능력을 아마도 과소평가했음을 보여준다”고 동의했다. (상자해파리 눈들에 관한 05/13/2005 기사와 이러한 현상에 대한 진화적 설명의 부족에 대한 11/19/2009 기사를 보라). (아래 관련자료링크 1번 참조).

2. 선천성 면역계 : ”획득되거나 적응된 면역계의 복잡함에 비해, 선천성 면역계(innate immune system)는 오히려 더 단순하고 둔감한 기구로 간주된다'”고 MedicalXpress의 한 논문은 말했었다. 그러나 이제 더 이상 그렇지 않다. 막스플랑크 연구소(Max Planck Institute)의 과학자들은 선천성 면역계의 일부인 호중구(neutrophils, 백혈구의 한 종류)가 침입자를 포획하기 위해 DNA-히스톤 섬유(DNA-histone filaments)의 정교한 네트워크를 펼칠 수 있음을 발견하고 놀랐다. ”과학자들은 그들의 눈을 믿을 수 없을 때, 그것은 매우 특이한 예외적인 것으로 말한다”라며 그 장황한 논문은 시작되고 있었다.

호중구는 감염 부위에 호출되었을 때, ‘호중구 세포밖 덫(NETs, Neutrophil Extracellular Traps)’을 형성하는 것이 발견되었다. ”주사전자현미경(SEM) 하에서. 그러한 NETs는 미세한 섬유들과 입자들로 나타나는데, 그것은 더욱 복잡한 구조를 형성하기 위해 실(threads)로 연결된다”고 논문은 말했다. ”이러한 형태의 구형(ball)을 만드는 것은 거기에 박테리아가 빠져들게 하기 위함이다. 이 구형의 주요 성분은 염색질(chromatin)이며, DNA와 단백질의 이러한 혼합물은 보통 세포핵에서 발견되고, 유전정보를 포함하고 있다”고 그 논문은 말했다.

단순하다고 생각했던 시스템에서 예상치 못한 복잡성의 발견은 면역계가 어떻게 작동되는지에 대한 다른 많은 단서들을 제공해줄 것이다. 그리고 면역계의 진화 도중에 돌연변이로 면역 기능이 정지됐다면, 그 생물은 뒤따르는 심각한 질병에서 어떻게 살아남았는가? 심지어 적응면역계(adaptive immune system)는 더욱 복잡한데, 어떻게 형성됐을까?

3. 프로테아좀 : 세포내의 단백질 '쓰레기'의 처리는 프로테아좀(proteasome, 진핵생물에 보편적으로 존재하는 거대 단백질 분해효소의 일종)이라 부르는 복잡한 기계의 몫이다. 쓰레기 수집보다 더 일상적인 일이 무엇일까? 그런데 바로 거기에 복잡한 메커니즘이 함께 작동되고 있었다. PhysOrg는 ”어떤 목표물을 파괴시킬 것인가를 결정하는데 두 개의 서로 다른 메커니즘이 필요하다”는 것을 보여주는 새로운 발견을 설명하고 있었다.

”그 기계의 쓰레기통에 들어가기 위해서는 ‘인식 태그(recognition tag)’와 ‘개시 태그(initiator tag)’ 두 가지가 함께 적절히 정렬되어야만 합니다”. ”프로테아좀은 서로 다른 플러그(plug)를 알아 볼 수 있습니다”. ”그러나 각각은 특별한 탐침(prongs, 뾰족한 끝)의 정확한 정렬을 가지고 있어야만 한다”고 노스웨스턴 대학의 연구자는 말했다.

프랑스 과학자들에 의해서 세포 내의 기계를 다룬 액틴(actin, 근육을 구성하며 그 수축에 작용하는 단백질의 일종) 섬유에 관한 새로운 비디오가  제작되었다 (PhysOrg을 보라). ”실과 같은 액틴섬유(actin filaments)는 시판되고 있는 플라스틱 만큼이나 강한데, 우리 세포의 힘센 일꾼입니다. 그것은 조직 내의 적절한 위치에서 세포들이 움직이도록 막을 밀어주고, 그들이 필요한 곳에서 세포의 모든 작동 부품들이 유지되도록 내부에 압력을 가하고 있습니다. 그리고 이러한 섬유들은 계속된 분열(splitting)과 재조합(reassembly)의 불가사의한 과정을 통해 그들의 일을 수행합니다”라고 선임연구자는 설명하고 있었다. 그 비디오는 그러한 세포 기계의 분열 과정을 보여주고 있다.



질문 : 하등한 생명체에서 보다 단순한 것이 발견될 것을 예상하는 세계관은 어떤 세계관인가? 그리고 어떤 세계관이 틀리고 있는가?

 


*참조 : 해파리도 사람과 흡사한 눈 가져 (2011. 4. 29. 연합뉴스)
http://www.yonhapnews.co.kr/economy/2011/04/29/0303000000AKR20110429098700009.HTML

해파리 `눈` 사람과 비슷하다 (2011. 4. 29. 디지털타임스)
http://www.dt.co.kr/contents.html?article_no=2011042902019954627018

노화방지의 열쇠 `멍게`에 있다. (2011. 5. 3. 이데일리)
http://www.edaily.co.kr/news/NewsRead.edy?newsid=01636726596245312&SCD=DH34&DCD=A00710

 


번역 - 문흥규

링크 - http://creationsafaris.com/crev201104.htm#20110428a

출처 - CEH, 2011. 4. 28.

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=5057

참고 : 3857|2899|3690|3034|4001|4524|2371|3854|4929|4879|4855|4700|4671|4088|4710|3768|3269|3267|4834|4788|4821|3977|4246|4064|5896|5773

Robert Carter
2019-07-03

4차원으로 작동되고 있는 사람 유전체 

: 유전체의 슈퍼-초고도 복잡성은 자연주의적 설명을 거부한다. 

(The four dimensional human genome defies naturalistic explanations)


      사람 유전체(human genome)는 우주 내에서 알려진 것들 중에서 가장 복잡한 컴퓨터 운영 시스템이다. 그것은 단일-분자적 정밀성으로 작동되는 초고도-복잡성의 생화학을 제어하고 있다. 유전체는 수십만 개의 단백질들의 양방향 네트워크를 조절하고 있다. 그것은 하나님의 경이로운 창조적 능력을 보여주는 동시에, 신다윈주의 이론의 과학적 파산을 가리키는 훌륭한 증거가 되고 있다. 그 이유는 무엇인가? 왜냐하면, 생명체의 복잡성이 점점 더 커질수록, 무작위적인 자연적 과정에 의한 진화론은 점점 더 그 가능성이 낮아지기 때문이다. 초고도 복잡성의 기계는 계획도 없고 방향도 없는 어떤 사고들에 의해서 우연히 생겨날 수 없다. 어떤 사고는 고장을 유발하지, 더 성능 좋은 기계로 변화시키지 못한다. 그리고 슈퍼-초고도 복잡성의 기계는 더더욱 무작위적인 변경으로 생겨날 수 없다.

그림 1 : 대장균(E. Coli, 왼쪽)과 리눅스 호출 그래프(Linux call graph, 오른쪽)의 전사 제어(control of transcription)의 비교. 대장균 세포는 비교적 적은 제어를(노란색 선과 보라색 선) 통해 많은 단백질 암호 유전자(하단의 녹색 선)들을 제어할 수 있다. 이에 비해 (명백한 지적설계의 결과인) 리눅스는 대장균에 훨씬 못 미치는, 비교적 적은 결과물을 제어하기 위해서, 훨씬 많은 고수준의 지침들을 필요로 한다.(From Yan et al. 2010.) [1]


컴퓨터 프로그램은 기본적으로 1차원이다. 사람의 유전체는 4차원으로 작동된다. 이것은 하나님의 창조적 능력이 얼마나 위대하신지를 보여주는 가장 강력한 증거 중 하나이다.

나는 유전체를 컴퓨터 운영시스템과 비교해보았을 때, 커다란 충격을 받았다. 이 둘을 비교해보았을 때, 이 세상의 어떤 컴퓨터도 유전체의 복잡성이나 효율성 측면에서 비교될 수 없었다. 그 비교도 가장 기초적 수준에서만 이루어질 수 있었다. 유전체는 극도로 복잡하고, 지속적으로 효율적으로 작동되고 있었다. 컴퓨터공학자들은 수많은 시간 동안 모든 기술력과 정보와 지식을 통해 프로그램들을 만들어낸 후에, 노트북이나 서버를 실행할 수 있는 운영시스템을 구축하게 된다. 그러나 그것도 결국 많은 장애들이 발생하고, 운영에 에러가 생긴다. 그러나 유전체에 들어있는 프로그램은 인체라 불리는 초고도 복잡성의 생물학적 기계를 완벽하게 운영 작동시키고 있다. 이 두 조직은 물론 근본적으로 다르다.


컴퓨터 과학자, 생물 물리학자, 생물 정보학자들로(정말로 똑똑한 사람들로) 구성된 한 연구팀은 하등한 대장균 박테리아의 유전체를 사람들이 만들어낸 리눅스(Linux) 운영 시스템과 비교해보았다(그림 1). 그리고 사람들이 만든 리눅스 운영 시스템이 훨씬 많은 상위 지침들을 가지고 있기 때문에, 훨씬 더 비효율적인 시스템이라는 것을 발견했다. 박테리아 유전체는 적은 수의 상위레벨 지침들을 가지고, 적은 수의 중간레벨 지침들을 제어하고, 이들은 많은 수의 단백질 암호 유전자들을 제어한다. 리눅스는 그 반대이다. 리눅스는 훨씬 많은 상위레벨 및 중간레벨의 지침들을 가지고 있으면서도, 매우 비효율적으로 그것을 제어한다. 대장균은 적은 제어로 많은 일을 할 수 있는 것이다. 유전체학(genomics)의 연구는 미래에 컴퓨터 발전에 커다란 영향을 미칠 것으로 예측되고 있다.


또한, 사람이 만든 컴퓨터는 비교적 간단한 프로그램을 사용한다. 컴퓨터 프로그래머는 '코드 라인 수(lines of code)'에 대해서 이야기한다. 우리는 수학 시간에서 선(line)은 1차원이라는 것을 배웠다. 그래서 컴퓨터 프로그램은 기본적으로 1차원이다. 이에 비해 사람 유전체는 4차원으로 작동된다. 이것은 하나님의 창조적 능력이 얼마나 위대하신지를 보여주는 가장 강력한 증거 중 하나인 것이다.


1차원 : DNA 분자

사람 유전체는 약 1.8m 길이이다. 그것 전부가 미세한 세포핵 내에 들어가 있다. DNA를 사람의 머리카락 굵기로 가정한다면, DNA의 길이는 50km 이상이 될 것이며, 대략 골프공 크기 안에 들어가 있는 것이 될 것이다. 이것 하나만으로도 하나님은 경이로운 엔지니어시라는 것을 알 수 있다.

DNA에 암호로 들어있는 문자들의 순서를 나열해 놓는다면, 그것은 다음과 같이 보일 것이다 :

CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGT

GGGTGGGAGCAGATTAGAGAATAAAAGCAGACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGT

CCCTTTCCATACTGTGGAAGCTTCGTTCTTTCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTT

GGGTCCACACTGCCTTTATGAGCTGTGACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCC

AGTGAGACCACAACCCCACCAGAAAGAAGAAACTCAGAACACATCTGAACATCAGAAGAAACAA

ACTCCGGACGCGCCACCTTTAAGAACTGTAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGA

AGTCAGTGAGACCAAGAACCCACCAATTCCAGACACACTAGGACCCTGAGACAACCCCTAGAAG

AGCACCTGGTTGATAACCCAGTTCCCATCTGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAG

CTCCTCATCTCTAACCCAGTTCCCCTGTGGGGATTTAGGGGACCAGGGACAGCCCGTTGCATGA

GCCCCTGGACTCTAACCCAGTTCCCTTCTGGAATTTAGGGGCCCTGGGACAGCCCTGTACATGA

GCTCCTGGTCTGTAACACAGTTCCCCTGTGGGGATTTAGGGACTTGGGCCTT

이것은 사람 Y 염색체(human Y chromosome)의 처음 700개의 글자이다. 동일한 염기서열을 가지고 4글자를 4색의 화소(pixels)로 대체한다면, 그림 2에서 보이는 것과 같은 것을 얻게 된다.[2] 이것은 매우 인상적이지 않은가?

그림 2 : 스키틀 유전체 시각화 도구(Skittle Genome Visualization Tool)를 사용하여 보여진 사람 Y 염색체의 시작 부분. 이 그림에서 많은 반복적인 DNA 요소(줄무늬)들을 볼 수 있다. 이러한 반복은 '유전자'를 포함하지 않을 수도 있지만, 3차원 공간의 특정 위치에서 유전자들을 유지하는 역할을 한다. 커다란 검은 영역은 인간 게놈 프로젝트(human genome project)가 생략하고(skip) 넘어갔던 반복 부분이다.(그들은 아직 매우 반복적인 DNA를 시퀀스 하는 기술이 없다). 유전체의 1차원을 나타내는 4개의 글자들을 순서대로 나열해놓은 많은 정보들이 있지만, 이것은 유전체의 전체 정보에 비하면 빙산의 일각으로 매우 적은 일부분에 불과하다.


유전체의 1차원은 단순히 글자들의 순서이다. 그 글자들은 유전자들에 적혀있는 것이고, 그 유전자들은 세포가 해야 할 일을 말해주고 있다. 이것도 복잡하지만, 상황은 더욱 복잡해진다.


2차원 : 상호작용하는 네트워크

유전체의 2차원은 DNA의 한 부분이 또 다른 부분과 상호작용하는 방법과 관련되어 있다. 우리가 이미 보았듯이, 1차원은 쉽게 그릴 수 있다. 그러나 2차원을 그리려면, 먼저 DNA의 선형 문자열의 다른 부분들을 연결하는 많은 화살표들을 그릴 필요가 있다. 그러나 유전체의 전체 상호작용 네트워크를 그린다는 것은 불가능하다. 그래서 한 작은 예만을 살펴보고자 한다.


마이크로 RNA(microRNA, miRNA)는 유전자 기능의 조절에 관여하는 매우 작은(약 22개 뉴클레오티드) 분자이다. 그림 3은 동맥경화증(atherosclerosis)에 대응하여 상향 조절되고 있는, 13개의 유전자들에서 작동되고 있는 miRNA 조절 네트워크의 한 부분을 보여주고 있다. 이들 유전자들은 262개 miRNAs에 의해 표적이 되고, 372개의 '조절 관계(regulatory relationships)'를 맺고 있다. 그림 3에 포함되지 않은 33개의 다른 유전자들이 있고, 그들은 295개의 miRNAs에 의해서 신체가 이러한 상황에 처할 때 하향 조절되고 있다. 기억해야만 하는 것은, 이것은 유전체의 2차원에 대한 극히 작은 부분에 불과하다는 것이다!

그림 3 : 유전체의 2차원에 대한 좋은 예가 되고 있는 miRNA 조절 네트워크의 일부분. 그림에서 오렌지색 영역은 동맥경화증과 관련하여 262개의 miRNAs(라벨을 가진 녹색 점)에 의해서 상향 조절되고 있는 13개의 유전자들을 나타낸다. 그리고 이들 miRNAs들은 유전체의 다른 부분에서 만들어진다. (after Lin et al. 2014).[3]


유전체의 2차원은 특이성 인자(specificity factors), 증강인자(enhancers,) 억제인자(repressors), 활성인자(activators), 전사인자(transcription factors) 같은 것들과 관련되어 있다. 이들은 DNA에 암호화되어 있는 단백질들이다. 그러나 그들은 만들어진 후에 유전체의 다른 부분으로 이동하고, 어떤 것의 스위치를 켜거나 끈다. 그러나 이 차원에서 일어나는 추가적인 것들이 있다. 단백질의 제조 공정 중에, 한 유전자는 ‘전사(transcription)’라 불리는 과정 동안에 세포에 의해서 '읽혀진다'. 여기에서, DNA는 RNA라 불리는 분자에 복사된다. 그리고 RNA는 한 단백질로 번역된다. 우리는 이 과정에 대한 훌륭한 애니메이션을 가지고 있다.(multimedia site). 그러나 전사후 조절(post-transcriptional regulation)이라 불리는 과정에서, RNA가 유전체의 또 다른 부위에 코딩되어 있는 다른 인자(miRNA 같은)에 의해서 활성화되기도 하고, 불활성화 되기도 한다.


수백만 달러의 연구자금이 들어갔던 엔코드 프로젝트(ENCODE project)는 아직 완전히 이해하지는 못하고 있었던, 유전체에 관한 어떤 것들을 밝혀냈다. 가장 큰 미스터리 중 하나는 약 22,000개의 유전자들이 300,000개 이상의 서로 다른 단백질들을 어떻게 생산하는지 그 방법에 관한 것이다. 그 답은 세포가 ‘선택적 스플라이싱(alternate splicing)’이라 불리는 한 과정을 통해서 진행한다는 것이다. 그 과정에서 유전자는 잘려지고, 조각나서, 다른 부분들이, 다른 시간에, 다른 세포들에 의해서 사용되어서, 다른 환경 하에서, 많은 다른 단백질들이 만들어지는 것이다. 이 믿을 수 없도록 극도로 복잡한 과정도 유전체의 2차원에서 단지 작은 한 부분에 불과한 것이다.


3차원 : DNA의 입체 구조

각 염색체는 핵 내에서 지정된 특별한 위치에 있을 뿐만 아니라, 함께 사용되는 유전자들은 일반적으로 서로 3차원 공간에서 인접하여 발견된다. 심지어 유전자들이 서로 다른 염색체에서 발견될 때에도 그렇다!

인간 게놈 프로젝트(Human Genome Project)로 밝혀진 가장 큰 사실중 하나는, 함께 사용되는 유전자들이 유전체 내에서 반드시 서로 가까이에 위치하지는 않는다는 것이었다. 진화론자들은 ”그것은 그냥 쓰레기(junk)이다”, 또는 ”유전체는 수백만 년의 시간 동안에 일어난 유전적 사고(genetic accidents)의 축적에 불과하다”와 같은 주장들을 했었다. 그러나 이러한 주장은 오래 가지 못했다. 왜냐하면, 과학자들이 유전체가 핵 안에서 어떻게 조직화되어 있는지를 살펴보기 시작했을 때[5], 각 염색체는 핵 안에서 지정된 특별한 위치를 가지고 있을 뿐만 아니라, 함께 사용되는 유전자들은, 심지어 다른 염색체에서 발견되는 유전자들이라도 일반적으로 3차원적 공간에서 서로 서로 인접하여 발견된다는 것을 알게 되었다. 


유전체의 3차원은 DNA 분자의 모양이 다른 유전자들의 발현과 조절에 어떻게 영향을 미치는지와 관련되어 있다. 우리는 감겨진 DNA 사슬 깊이 묻혀있는 DNA 부분이 쉽게 활성화될 수 없다는 것을 알고 있다.[4] 그래서 자주 사용되는 유전자들은 일반적으로 쉽게 접근할 수 있는 위치에 있다. 따라서 하나님이 1차원적 DNA 가닥에 유전정보를 써넣으실 때에, DNA가 3차원 모양으로 접혀졌을 때에 서로 정확한 위치들에 위치하도록, 의도적으로 어떤 순서를 가지고 그것들을 써넣으셨어야만 했다. 

그림 4. 핵 내에서 사람 염색체의 3D 위치. 깊게 매립된 유전자들은 접근하기가 쉽지 않기 때문에, 염색체의 입체적(3차원) 접혀짐은 유전체의 전체 기능에 있어서 엄청나게 중요하다. (from Bolzer).[5]


4차원 : 처음의 3차원이 변경됨

유전체의 4차원은 시간(time)이 흐르면서 처음의 3차원이 변경되는 것과 관련되어 있다. 그렇다. 도저히 믿을 수 없어 보이지만, 그것이 사실이다. 모양(3차원), 상호 네트워크(2차원), 글자 순서(1차원), 모든 것들이 변경된다. 이것은 지금까지 유례가 없는 것으로, 인간이 만든 가장 최첨단 컴퓨터도 따라올 수 없는 것이다.


4차원은 여러 가지 방법으로 설명될 수 있다. 다른 간세포(liver cells)들은 다른 염색체 수를 가지고 있다는 것이 알려져 있다.[6] 이것은 간은 대사 및 해독에 관여하는 어떤 유전자의 복사본을 많이 필요로 한다는 사실에 기인한다. 간은 이들 유전자들의 많은 복사본들로 유전체를 채우는 대신에, 자신의 사용을 위한 복사본들을 만든다. 또한 다른 뇌 세포(brain cells)들은 다양한 트랜스포존(transposons)을 다른 수로, 그리고 다른 위치에 갖고 있다.[7] 진화론자들은 이들 점핑유전자(jumping genes)들을 고대 바이러스 감염으로부터 남겨진 유물로 생각했었다. 문제는 그것들이 사람 뇌의 발달에 있어서 필수적이라는 것이다. 무슨 의미인지 알겠는가? 유전체는 다이내믹하게 자신을 재프로그램 시킨다. 이것은 컴퓨터 과학자들이 오랫동안 해결하려고 애써왔던 것이다. 당신은 통제를 벗어나지 않으면서 자가-변경되는 암호를 만들 수 있겠는가? 또한 트랜스포존은 마우스의 배아 발달을 조절하는 데에 중요하다는 것이 밝혀졌다.[8] 그러한 놀라운 부분을 진화론자들은 오랫동안 '정크 DNA(쓰레기 DNA)'라 불러왔던 것이다!


결론

유전체는 극도로 복잡한 생물학적 컴퓨터(biological computer)에 내장되어 있는, 오류를 자체 수정하며, 스스로 암호를 변경하는, 다중 차원의 운영시스템이다. 거기에는 여러 중첩된(이중) DNA 암호, RNA 암호, 구조 암호들이 들어 있다. 거기에는 DNA 유전자들 및 RNA 유전자들이 들어 있다. 유전체는 그것의 구축 동안에 생물공학적 원리들을 사용하셨던, 고도의 지적 존재에 의해서, 많은 량의 여분(redundancy)들이 있도록 의도적으로 설계되었다. 그러한 여분에도 불구하고, 22,000개 정도의 단백질 암호 유전자들이 상호 협력하여, 수십만 개의 독특한 단백질들을 한 치의 오차도 없이 만들어내도록, 경이로운 수준으로 치밀하게 압축되어 있는 것이다.


나는 진화론자들에게 도전을 하나 하겠다. 유전체의 기원을 설명해보라. 찰스 다윈(Charles Darwin)은 ‘종의 기원’에서 썼다 :

”만약 다수의, 연속적인, 약간의 변경들에 의해서 형성될 수 없을 것 같은, 어떤 복잡한 기관의 존재가 입증된다면, 나의 이론은 완전히 무너질 것이다.”

나는 이 인용문이 (창조/진화 논쟁에서) 남용되고 있다는 것을 알고 있다. 그러나 잠시라도 이것에 대해서 생각해보라. 간단한 생명체는 다윈의 관점으로 설명하기에 쉬웠다. 그러나 더 복잡한 생명체에 대해서는 그 문제는 더욱 어려운 문제가 되고 있다. 유전체는 앞에서 살펴본 것처럼, 극도로 초고도로 복잡하다. 이것은 진화론자들을 매우 불편하게 만들고 있는 것이다.


유전체는 알려진 자연적 과정을 통해서는 절대로 생겨날 수 없다고 나는 생각한다. 이 도전에 응전하기를 원하는 진화론자는 정보 변경의 원인, 필요한 돌연변이의 양, 필요한 선택적 힘... 등이 모두 적절한 시간에 작동되도록 하는 것 등을 포함하여, 적절한 시나리오를 우리에게 보내 달라. 진화론자들은 수십억 년이 걸린다하더라도, 무작위적인 자연적 과정은 그들이 필요로 하는 것을 만들 수 없다는 것을 발견하게 될 것이다. (참고 : DVD ‘The High Tech Cell).



Related Articles
Splicing and dicing the human genome


References and notes
1. Yan, K.-K., et al., Comparing genomes to computer operating systems in terms of the topology and evolution of their regulatory control networks. PNAS 107(20):9186-9191, 2010.
2. Seaman, J., and Sanford, J., Skittle: a 2-dimensional genome visualization tool. BMC Bioinformatics 10:452, 2009.
3. Lin, M., Zhao, W., and Weng, J., Dissecting the mechanism of carotid atherosclerosis from the perspective of regulation, International Journal of Molecular Medicine 34:1458-1466, 2014.
4. van Berkum, N.L., Hi-C: a method to study the three-dimensional architecture of genomes, Journal of Visualized Experiments 6(39):1869, 2010.
5. Bolzer, A., et al., Three-dimensional maps of all chromosomes in human male fibroblast nuclei and prometaphase rosettes, PLoS Biol 3(5):e157, 2005.
6. Duncan, A.W., et al., The ploidy conveyor of mature hepatocytes as a source of genetic variation, Nature 467:707-710, 2010.
7. Baillie, J.K., et al., Somatic retrotransposition alters the genetic landscape of the human brain, Nature 479:534-537, 2011.
8. Tomkins, J., 2012. Transposable Elements Key in Embryo Development; icr.org/article/6928, July 25, 2012.


*관련기사 : 생명체의 정보 기원, '창조주'에서 찾아야만 한다 (2016. 10. 12. 기독일보)
http://www.christiandaily.co.kr/news/72305.html


*관련 동영상 : RNA Splicing


https://www.youtube.com/watch?v=aVgwr0QpYNE

Scientists discover second, secret DNA code


https://www.youtube.com/watch?v=-o_Cj9yDrM4

DNA - God's amazing programming; evidence for his existence


https://www.youtube.com/watch?v=CBeCxKzYiIA

The Mysterious Epigenome. What lies beyond DNA.

https://www.youtube.com/watch?v=RpXs8uShFMo

생명정보의 증거 (youtube 동영상, 한글 자막)


https://www.youtube.com/watch?v=xgiullkAeeY

DNA는 왜 창조를 증거하는가? (youtube 동영상, 한글자막)


https://www.youtube.com/watch?v=F-yRL-I6Edk



번역 - 미디어위원회

링크 - http://creation.com/four-dimensional-genome

출처 - CMI, 2016. 10. 6. (GMT+10)

구분 - 5

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6468

참고 : 6207|6126|6361|6321|6389|6148|5831|6003|5836|5580|5474|6134|5883|5734|5784|5950|5558|5454|5954|5949|6286|5725|5536|5441|5105|5094|5514|3730|512|921|3935|5458|4824|5952|6243|5863|5226|4831|4315|4736|2065|6319|4998|4503|5443|6119|5969|4982|2697|5704|5251|5456|4182|4710|4366|6009|6000

생물들의 놀라운 기술과 생체모방공학 

: 이러한 기술들이 모두 우연히 생겨났을까? 

(Inspiring Life Tricks)


    이러한 기술들은 특허를 받기에 충분하다.


동물들의 놀라운 기술

사막도마뱀(desert lizard)은 발과 등을 통해 모래로부터 물을 마실 수 있다 (New Scientist. 2016. 11. 2) : ”이 무슨 기괴한 일인가? 가시 많은 사막도마뱀은 피부 전체에 나있는 그물망과 같은 빨대들을 사용하여, 물기 있는 모래에서 물을 흡수하고 있었다”고 그 기사는 말했다. 누군가는 이 아이디어로 유용한 제품을 만들 수 있을 것이다. 이 도마뱀은 ”사막에서 신선한 물을 모으는 기술에 영감을 줄 수 있다”는 것이다.


CT 스캔으로 조류의 내장형 에어컨이 발견됐다 (Science Daily. 2016. 11. 9) : 과학자들은 조류 부리에 대한 CT 스캔을 하고나서, 발견한 복잡성에 놀라고 있었다. 생체모방에 대해서 언급하지는 않았지만, 사진과 함께 그들의 흥분을 감안할 때, 그것은 논리적으로 새 부리의 기원에 관한 논란을 불러일으키고 있었다.

”새의 부리 내에서 발생하는 체온조절 과정에 대해 궁금해지면서, 우리는 국소적 기후에 의한 외측 표면의 열 손실과 적응에 중점을 두고, 일종의 열 방열기(heat radiator)로서 새 부리(bird bill)의 기능을 연구해왔었다”고 댄너(Danner)는 말했다. ”나는 컴퓨터 주변에 둘러서서, 첫 번째 스캔 작업의 결과를 깜짝 놀란 표정으로 바라보고 있었던, 처음의 연구원들을 기억한다. 고해상도의 스캔 결과는 경험 많은 조류학자들도 결코 보지 못했던, 아니 상상조차하지 못했던, 많은 구조물을 밝혀냈다. 그리고 우리는 즉각적으로 전방 비갑개(anterior conchae)의 화려한 구조의 아름다움에 빠져버렸다.”


딱따구리가 두통을 겪지 않는 이유는? (National Geographic. 2016. 11. 5) : 딱따구리(woodpecker)의 부리가 반복적으로 나무에 부딪쳐도 손상이 없는 것은, 딱따구리의 머리와 몸에 있는 특수 구조 때문이라는 것이다. 저자인 리즈 랭글리(Liz Langley)의 말에 따르면, 그것은 ”훌륭한 진화적 설계”라는 것이다. 그 설계는 지성적 인간이 모방하기에도 충분할 정도의 복잡한 설계임을 리즈도 인정하고 있었다 : ”충격을 흡수할 수 있는 딱따구리의 능력은 미식축구와 같은 운동선수에서 뇌진탕을 감소시킬 수 있는 시스템의 개발에 영감을 불어 넣고 있다.”


홍합의 능력: 연구자들은 수중 접착제를 개발했다 (Phys.org. 2016. 11. 3) : 젖은 반창고는 쉽게 떨어진다. 이에 대해 한 기자는 말했다. ”강한 접착제라도 젖었을 때는 접착력이 떨어진다. 그러나  자연에서 영감을 받은 한 연구자는 미국 해군연구국(Office of Naval Research, ONR)의 지원을 받아, 젖은 상태에서도 접착력이 있는 접착제를 개발했다.” 그는 홍합(mussels)의 비밀을 알아냈던 것이다.


곤충은 더 나은 기술의 창출 방법을 우리에게 가르쳐 줄 수 있다. (The Conversation. 2016. 11. 8) :  Predrag Slijepcevic 지에 논문을 게재한 연구자들은 환경에 해를 끼치지 않고 협력하는, 개미, 흰개미, 다른 곤충들의 원래의 진사회성(eusociality)을 연구하고 있었다. 그러나 그들의 사회성은 신분제도(caste systems), 노예 제도와 함께 잔인할 수 있다. 그는 아마도 일개미처럼 살고 싶지는 않을 것이다. 그러나 솔로몬은 ”게으른 자여 개미에게 가서 그가 하는 것을 보고 지혜를 얻으라”(잠 6:6)라고 말하고 있다.


식물들의 놀라운 기술

인공합성 잎과 실제 잎의 기공 설계의 원칙 (Phys.org. 2016. 11. 7) : 그 기사의 맨 위에 있는 왕립학회(Royal Society)가 제공한 사진은 ‘기공(stomata)’이라 불리는 식물 잎의 기체 교환 구멍의 '설계 원리'에 대한 논의로 이어지고 있었다. ”이 논문은 빛, 물, 이산화탄소 이용률과 같은 환경요인들과 기공의 디자인과 관련한 식물 생산성 사이의 연관성을 이해하기 위해서, 생체모방 실험과 이론을 결합한, 기공의 기하학(stomata geometry)을 살펴보고 있었다.”


광합성 안테나 복합체에 관한 연구는 식물, 조류(algae), 박테리아가 빛을 어떻게 수확하는지를 밝혀내었다. (Phys.org. 2016. 11. 4) : 질문 - 진화론이나 지적설계가 워싱턴 대학의 과학자들에게 영감을 주었는가?

모든 숲길과 머리 위로 흔들리는 나뭇가지 아래로 걸어갈 때, 당신은 에너지를 수집하는, 세계에서 가장 효율적인 수십억 개의 시스템으로 둘러싸여 있는 것이다. 모든 나뭇잎, 풀잎, 조류 세포 안에는, 광합성 안테나 복합체(photosynthetic antenna complexes)라고 불리는 단백질 집합체와 작은 색소들이 햇빛을 포집한다.

안테나 복합체에 대한 향상된 이해는, 과학자들이 나뭇잎을 모방하여, 햇빛을 전기나 연료로 바꿀 수 있는 인공시스템을 개발하는데 도움이 될 수 있다. 또한 식물, 조류, 미생물에서의 광합성 과정을 보다 효율적으로 만들 수 있는 기반을 마련할 수 있다.

버섯으로 만들어진 의자 : 유기체 제조 산업의 미래는 어떨까?(Phys.org. 2016. 11. 14) : 균류(fungi)는 식물이 아니지만(식물의 분류 체계에 따라), 몇 가지 특징을 가지고 있다. Ecovative Systems이라는 회사는 균류 물질로 공원 벤치를 만들고 있다. ”뉴욕의 공장 위층에서 만들어진, 튼튼한 의자와 푹신한 쿠션은 균류로 만들어진 것입니다”라고 그 기사는 말한다. 장점은 무엇인가? 그들은 주형 안으로 스스로 조립되어 만들어지고, 쿠션처럼 부드럽지만, 강하고, 환경 친화적이라는 것이다. 그렇다면 과학에서 생체모방공학(biomimetics)은 좋은 것인가? 오타와 대학교 앤드류 펠링(Andrew Pelling)에게 물어보았다 :

”우리는 지금 생물학적 석기시대에 살고 있다” 그는 말했다. ”우리는 생물학이 얼마나 복잡한지를 과소평가해서는 안 된다고 생각한다. 그리고 그들의 성장과 수선을 이해하고 조절하기 전에 알아야만 하는 것들에 아직도 많은 미스터리들이 있다고 생각한다.” 펠링은 말했다. ”나에게 이것은 정말로 흥분되는 분야이다.”


세포의 놀라운 기술

규조류(diatoms)의 힘으로 센서 성능을 극적으로 향상시킨 새로운 기술(Science Daily. 2016. 11. 8) : 이 기사는 하나의 기적을 전하고 있었다. 말하자면, ”오리건 주립대학(Oregon State University)의 연구자들은 자연의 작은 기적 중 하나인 규조류와 잉크젯 프린팅 및 광센싱(optical sensing)을 결합하여, 다른 일반적인 방법보다 최대 1000만(10 million) 배나 더 민감한 감지 장치(sensing device)를 만들어내었다.”


유전물질로 만들어진 컴퓨터? 과학자들은 DNA-기반 나노와이어(DNA-based nanowires)를 사용하여, 전기를 전도시켰다.(Science Daily. 2016. 11. 9) : 실리콘 칩(silicon chips)이 이론적 한계에 다다랐다. 이제 DNA의 경이로운 구성조직에 영감을 얻을 수는 없는 것일까? ”한 가지 방법은 분자와 원자로부터 복잡한 구성요소들의 자기-조직화(self-organization)가 될 수 있다”고 그 기사는 말한다. ”과학자들은 이제 중요한 진전을 이루었다. 물리학자들은 하나의 DNA 가닥에서 독립적으로 자가 조립된, 금이 도금된 나노와이어를 통해 전류를 전달했다.”


화학자들은 자연을 모방하여 세포기관들의 집합체를 만들었다 (Science Daily. 2016. 11. 2) : 바젤 대학(University of Basel)의 과학자들은 분자 공장(molecular factories)을 발명하고자 했다. 그래서 그들은 세포가 어떻게 작동하는지 연구하고 있다. 이 기사는 세포가 '자기-조직화 (self-organization)'에 의해 그렇게 하는데, 물질에 지시를 하는 유전자 암호 내의 소프트웨어 때문이라고 말한다. 지적설계는 그들의 설명에서 분명히 나타나 있다. ”이 전략은 실제 자기조직화 방식을 뛰어 넘는 것이다. 왜냐하면 그것은 구획 사이 거리, 또는 수요에 따른 다른 위상들의 미세한 조정 같은 여러 다양한 요구들을 통합할 수 있기 때문이다.”


생물에서 영감 받은 질산염과 과염소산염 환원을 위한 철 촉매(Science Magazine. 2016. 11. 11) : 질산염(nitrates)과 과염소산염(perchlorates)은 농업에서 유용하게 사용되어왔기 때문에, 오염되어 있다. 이들 물질을 분해하는 효소에 영감을 얻은 과학자들은, 활성 부위를 모방한, 인공촉매(artificial catalyst)를 개발했다. 그 촉매는 오염물질을 분해할 때, 그 자체가 재생되고, DHMO(dihydrogen monoxide, 물)을 방출한다.


생물의 속도에서 생체전자공학 (Science Daily. 2016. 11. 2) : 세포막에서 고도로 선택적인 채널은 유럽의 과학자들에게 영감을 주었다 : ”유기 전자부품으로 만들어진 마이크로제조 이온 펌프”. 당신의 발가락이 무언가로부터 찔렸을 때, 신경이 얼마나 빨리 뇌로 메세지를 전달하는지를 생각해보라. 이 새로운 장치를 통해서, ”이온(ions)은 신경계의 전달 속도를 가지고, 그리도 단일 세포의 정밀도를 가지고, 신경세포 또는 근육세포로 전송될 수 있다.” 자연이 매일 하고 있는 일을 과학자들이 쫒아오는 데에 10년의 노력이 필요했다.



우리는 계속해서 독자들에게 자연의 뛰어난 기술에 영감을 얻은 '설계적 사고(design thinking)'는 과학의 미래라고 말해왔다. 자연계에서 보여지는 설계들을 연구하고, 이해하고, 모방하는 일은 지구 행성과 인류에게 유익한 열매를 맺게 해줄 것이다. 또한 생체모방공학에 관한 기사들은 생명의 기원에 대한 진화론적 주장만을 강요할 수 없게 만들고 있는 것처럼 보인다. 사람들이 모방하고 싶어할 정도의 이러한 경이로운 기술들이, 계획도 없고, 지성도 없고, 방향도 없는, 무작위적인 복제 실수로 모두 우연히 어쩌다가 생겨났단 말인가? 이 분야에서 진화론은 매우 신뢰할 수 없는 이론으로 보이는 것이다.

 


*생체모방 관련 최근 기사 :

고양이 혀 원리를 로봇에 적용하면?  (2016. 11. 25. 전자신문)
http://www.etnews.com/20161124000422

스스로 깨끗함을 유지하는 자기세정 기능을 가진 연잎 (2016. 11. 22. 중앙일보)
http://www.koreadaily.com/news/read.asp?art_id=4786993

곤충이 날개짓 할 때 만드는 작은 소용돌이가 비행성능 2배 향상  (2016. 11. 10. 뉴스1)
http://news1.kr/articles/?2827317

DNA 미세로봇 개발…A,T,G,C ‘4진수’ 정보 이용 (2016. 11. 11. IT뉴스)
http://www.itnews.or.kr/?p=19994

뇌신경 모방 딥러닝 기반 인공지능 혈압측정 기술 개발 (2016. 11. 11. IT뉴스)
http://www.itnews.or.kr/?p=19970

전남도, 생체모방기술 산업화 공식 추진  (2016. 10. 24. 노컷뉴스)
http://www.nocutnews.co.kr/news/4673568

찔러도 피 안나는 주사...KAIST 연구진, 홍합 모방한 생체 지혈 재료 개발 (2016. 10. 5. 조선비즈)
http://biz.chosun.com/site/data/html_dir/2016/10/06/2016100601940.html

‘거미 비단’이 섬유혁명 일으킨다. (2016. 8. 9. Science Time)
http://www.sciencetimes.co.kr/?news=거미-비단이-섬유혁명-일으킨다

갯가재에서 영감 얻은 초강력 소재 (2016. 7. 11. Science Time)
http://www.sciencetimes.co.kr/?news=갯가재에서-영감-얻은-초강력-소재

근육, 움직임까지…생체 모방 가오리 바이오 로봇 개발  (2016. 7. 8. KBS News)
http://news.kbs.co.kr/news/view.do?ncd=3308385

반딧불이 생체 모방하니, OLED 발광효율 높아졌네  (2016. 6. 8. 사이언스온)
http://scienceon.hani.co.kr/406671?_fr=mb2

사하라 사막에서 채소를 기르는 방법 (2016. 5. 20. 뉴스토마토)
http://www.newstomato.com/readNews.aspx?no=656441

생체모방 기획전 ‘생물로부터 배운다’ (2016. 5. 17. 에코타임스)
http://www.ecotiger.co.kr/news/articleView.html?idxno=17162

성게 이빨 모방한 우주탐사장비 (2016. 5. 16. Science Time)
http://www.sciencetimes.co.kr/?news=성게-이빨-모방한-우주탐사장비

게코도마뱀 모방 전도성 접착패드로 생체정보 측정  (2016. 3. 28. Science Time)
http://www.sciencetimes.co.kr/?news=게코도마뱀-모방-전도성-접착패드로-생체정보-측정

바다오리 모방한 비행잠수로봇 (2015. 12. 8. Science Time)
http://www.sciencetimes.co.kr/?news=바다오리-모방한-비행잠수로봇

서울대-LG전자, 혹등고래 등 생체모방 기술로 고효율 팬 개발(2015. 11. 5. 전자신문)
http://www.etnews.com/20151105000057



번역 - 미디어위원회

링크 - http://crev.info/2016/11/inspiring-life-tricks/

출처 - CEH, 2016. 11. 14.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6494


참고 : 6199|5960|5932|5926|5894|5856|5694|5689|5671|5656|5600|5596|5567|6162|5997|5551|5504|5430|5426|5352|5351|5287|5142|5088|4764|4728|4041|6492|6475|6406|6336|6324|6308|6304|6302|6291|6290|6289|6272|6245|6178|6165|6163|6160|6159|6137|6069|6034|6023|6001|5976|5975|5962|5959|5934|5920|5438|5902|5899|5896|6402|6391|6309|6269|6236|6200|6114|6057|6056|6053|6050|5978|5956|5938|5933|5855|5823|5788|5778|5774|5772|5763|5757|5754

HEADLINE

창조말씀 365

대저 산들을 지으며 바람을 창조하며 자기 뜻을 사람에게 보이며 아침을 어둡게 하며 땅의 높은데를 밟는 자는 그 이름이 만군의 하나님 여호와니라 [아모스 4:13]


서울특별시 중구 삼일대로 4길 9 라이온스 빌딩 401호

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

Copyright ⓒ 한국창조과학회