태초에 하나님이 천지를 창조하시니라 (창세기 1:1)

LIBRARY

KOREA  ASSOCIATION FOR CREATION RESEARCH

창조설계

단순한 생명체에서 고도의 복잡성이 발견되었다. 

: 하등한 해파리가 사람과 흡사한 눈을 가졌다? 

(More Complexity in Simplicity Found)


      2011. 4. 28 - 원시적 생명체란 없다. 단순한 생명체에서 고도의 복잡성이 발견되는 최근의 몇 가지 이야기들은 이제 진부한 이야기가 되는 것 같다.

1. 상자해파리의 눈 : 해파리는 가장 단순한 동물에 속한다. 그런데 왜 상자해파리(box jellyfish)는 뇌(brain)도 없이 24개나 되는 눈들을 가지고 있을까? 이제 이러한 눈들의 일부는 물 위에 있는 물체를 탐지하기 위한 것으로 밝혀졌는데, 그것은 해파리가 망그로브(mangrove) 서식지에서 머물 수 있도록 해준다는 것이다. (New Scientist, Live Science, PhysOrg을 보라).

어떻게 중추신경계(central nervous system)도 없는 해파리 같은 동물이 눈으로 들어오는 신호를 받아들이고, 협동적인 움직임으로 반응하는지 불가해한 일이다. New Scientist 지에서 한 해양학자는 ”우리는 단순한 생물체에 있는 감각계가 어떻게 상당히 복잡한 생물 적응(adaptation)에 사용되었는지에 대해 잘 알지 못하고 있다”고 말했다. 또 다른 연구자도 Live Science에서, ”이러한 사실은 해파리와 같은 단순한 동물의 행동능력을 아마도 과소평가했음을 보여준다”고 동의했다. (상자해파리 눈들에 관한 05/13/2005 기사와 이러한 현상에 대한 진화적 설명의 부족에 대한 11/19/2009 기사를 보라). (아래 관련자료링크 1번 참조).

2. 선천성 면역계 : ”획득되거나 적응된 면역계의 복잡함에 비해, 선천성 면역계(innate immune system)는 오히려 더 단순하고 둔감한 기구로 간주된다'”고 MedicalXpress의 한 논문은 말했었다. 그러나 이제 더 이상 그렇지 않다. 막스플랑크 연구소(Max Planck Institute)의 과학자들은 선천성 면역계의 일부인 호중구(neutrophils, 백혈구의 한 종류)가 침입자를 포획하기 위해 DNA-히스톤 섬유(DNA-histone filaments)의 정교한 네트워크를 펼칠 수 있음을 발견하고 놀랐다. ”과학자들은 그들의 눈을 믿을 수 없을 때, 그것은 매우 특이한 예외적인 것으로 말한다”라며 그 장황한 논문은 시작되고 있었다.

호중구는 감염 부위에 호출되었을 때, ‘호중구 세포밖 덫(NETs, Neutrophil Extracellular Traps)’을 형성하는 것이 발견되었다. ”주사전자현미경(SEM) 하에서. 그러한 NETs는 미세한 섬유들과 입자들로 나타나는데, 그것은 더욱 복잡한 구조를 형성하기 위해 실(threads)로 연결된다”고 논문은 말했다. ”이러한 형태의 구형(ball)을 만드는 것은 거기에 박테리아가 빠져들게 하기 위함이다. 이 구형의 주요 성분은 염색질(chromatin)이며, DNA와 단백질의 이러한 혼합물은 보통 세포핵에서 발견되고, 유전정보를 포함하고 있다”고 그 논문은 말했다.

단순하다고 생각했던 시스템에서 예상치 못한 복잡성의 발견은 면역계가 어떻게 작동되는지에 대한 다른 많은 단서들을 제공해줄 것이다. 그리고 면역계의 진화 도중에 돌연변이로 면역 기능이 정지됐다면, 그 생물은 뒤따르는 심각한 질병에서 어떻게 살아남았는가? 심지어 적응면역계(adaptive immune system)는 더욱 복잡한데, 어떻게 형성됐을까?

3. 프로테아좀 : 세포내의 단백질 '쓰레기'의 처리는 프로테아좀(proteasome, 진핵생물에 보편적으로 존재하는 거대 단백질 분해효소의 일종)이라 부르는 복잡한 기계의 몫이다. 쓰레기 수집보다 더 일상적인 일이 무엇일까? 그런데 바로 거기에 복잡한 메커니즘이 함께 작동되고 있었다. PhysOrg는 ”어떤 목표물을 파괴시킬 것인가를 결정하는데 두 개의 서로 다른 메커니즘이 필요하다”는 것을 보여주는 새로운 발견을 설명하고 있었다.

”그 기계의 쓰레기통에 들어가기 위해서는 ‘인식 태그(recognition tag)’와 ‘개시 태그(initiator tag)’ 두 가지가 함께 적절히 정렬되어야만 합니다”. ”프로테아좀은 서로 다른 플러그(plug)를 알아 볼 수 있습니다”. ”그러나 각각은 특별한 탐침(prongs, 뾰족한 끝)의 정확한 정렬을 가지고 있어야만 한다”고 노스웨스턴 대학의 연구자는 말했다.

프랑스 과학자들에 의해서 세포 내의 기계를 다룬 액틴(actin, 근육을 구성하며 그 수축에 작용하는 단백질의 일종) 섬유에 관한 새로운 비디오가  제작되었다 (PhysOrg을 보라). ”실과 같은 액틴섬유(actin filaments)는 시판되고 있는 플라스틱 만큼이나 강한데, 우리 세포의 힘센 일꾼입니다. 그것은 조직 내의 적절한 위치에서 세포들이 움직이도록 막을 밀어주고, 그들이 필요한 곳에서 세포의 모든 작동 부품들이 유지되도록 내부에 압력을 가하고 있습니다. 그리고 이러한 섬유들은 계속된 분열(splitting)과 재조합(reassembly)의 불가사의한 과정을 통해 그들의 일을 수행합니다”라고 선임연구자는 설명하고 있었다. 그 비디오는 그러한 세포 기계의 분열 과정을 보여주고 있다.



질문 : 하등한 생명체에서 보다 단순한 것이 발견될 것을 예상하는 세계관은 어떤 세계관인가? 그리고 어떤 세계관이 틀리고 있는가?

 


*참조 : 해파리도 사람과 흡사한 눈 가져 (2011. 4. 29. 연합뉴스)
http://www.yonhapnews.co.kr/economy/2011/04/29/0303000000AKR20110429098700009.HTML

해파리 `눈` 사람과 비슷하다 (2011. 4. 29. 디지털타임스)
http://www.dt.co.kr/contents.html?article_no=2011042902019954627018

노화방지의 열쇠 `멍게`에 있다. (2011. 5. 3. 이데일리)
http://www.edaily.co.kr/news/NewsRead.edy?newsid=01636726596245312&SCD=DH34&DCD=A00710

 


번역 - 문흥규

링크 - http://creationsafaris.com/crev201104.htm#20110428a

출처 - CEH, 2011. 4. 28.

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=5057

참고 : 3857|2899|3690|3034|4001|4524|2371|3854|4929|4879|4855|4700|4671|4088|4710|3768|3269|3267|4834|4788|4821|3977|4246|4064|5896|5773

Robert Carter
2019-07-03

4차원으로 작동되고 있는 사람 유전체 

: 유전체의 슈퍼-초고도 복잡성은 자연주의적 설명을 거부한다. 

(The four dimensional human genome defies naturalistic explanations)


      사람 유전체(human genome)는 우주 내에서 알려진 것들 중에서 가장 복잡한 컴퓨터 운영 시스템이다. 그것은 단일-분자적 정밀성으로 작동되는 초고도-복잡성의 생화학을 제어하고 있다. 유전체는 수십만 개의 단백질들의 양방향 네트워크를 조절하고 있다. 그것은 하나님의 경이로운 창조적 능력을 보여주는 동시에, 신다윈주의 이론의 과학적 파산을 가리키는 훌륭한 증거가 되고 있다. 그 이유는 무엇인가? 왜냐하면, 생명체의 복잡성이 점점 더 커질수록, 무작위적인 자연적 과정에 의한 진화론은 점점 더 그 가능성이 낮아지기 때문이다. 초고도 복잡성의 기계는 계획도 없고 방향도 없는 어떤 사고들에 의해서 우연히 생겨날 수 없다. 어떤 사고는 고장을 유발하지, 더 성능 좋은 기계로 변화시키지 못한다. 그리고 슈퍼-초고도 복잡성의 기계는 더더욱 무작위적인 변경으로 생겨날 수 없다.

그림 1 : 대장균(E. Coli, 왼쪽)과 리눅스 호출 그래프(Linux call graph, 오른쪽)의 전사 제어(control of transcription)의 비교. 대장균 세포는 비교적 적은 제어를(노란색 선과 보라색 선) 통해 많은 단백질 암호 유전자(하단의 녹색 선)들을 제어할 수 있다. 이에 비해 (명백한 지적설계의 결과인) 리눅스는 대장균에 훨씬 못 미치는, 비교적 적은 결과물을 제어하기 위해서, 훨씬 많은 고수준의 지침들을 필요로 한다.(From Yan et al. 2010.) [1]


컴퓨터 프로그램은 기본적으로 1차원이다. 사람의 유전체는 4차원으로 작동된다. 이것은 하나님의 창조적 능력이 얼마나 위대하신지를 보여주는 가장 강력한 증거 중 하나이다.

나는 유전체를 컴퓨터 운영시스템과 비교해보았을 때, 커다란 충격을 받았다. 이 둘을 비교해보았을 때, 이 세상의 어떤 컴퓨터도 유전체의 복잡성이나 효율성 측면에서 비교될 수 없었다. 그 비교도 가장 기초적 수준에서만 이루어질 수 있었다. 유전체는 극도로 복잡하고, 지속적으로 효율적으로 작동되고 있었다. 컴퓨터공학자들은 수많은 시간 동안 모든 기술력과 정보와 지식을 통해 프로그램들을 만들어낸 후에, 노트북이나 서버를 실행할 수 있는 운영시스템을 구축하게 된다. 그러나 그것도 결국 많은 장애들이 발생하고, 운영에 에러가 생긴다. 그러나 유전체에 들어있는 프로그램은 인체라 불리는 초고도 복잡성의 생물학적 기계를 완벽하게 운영 작동시키고 있다. 이 두 조직은 물론 근본적으로 다르다.


컴퓨터 과학자, 생물 물리학자, 생물 정보학자들로(정말로 똑똑한 사람들로) 구성된 한 연구팀은 하등한 대장균 박테리아의 유전체를 사람들이 만들어낸 리눅스(Linux) 운영 시스템과 비교해보았다(그림 1). 그리고 사람들이 만든 리눅스 운영 시스템이 훨씬 많은 상위 지침들을 가지고 있기 때문에, 훨씬 더 비효율적인 시스템이라는 것을 발견했다. 박테리아 유전체는 적은 수의 상위레벨 지침들을 가지고, 적은 수의 중간레벨 지침들을 제어하고, 이들은 많은 수의 단백질 암호 유전자들을 제어한다. 리눅스는 그 반대이다. 리눅스는 훨씬 많은 상위레벨 및 중간레벨의 지침들을 가지고 있으면서도, 매우 비효율적으로 그것을 제어한다. 대장균은 적은 제어로 많은 일을 할 수 있는 것이다. 유전체학(genomics)의 연구는 미래에 컴퓨터 발전에 커다란 영향을 미칠 것으로 예측되고 있다.


또한, 사람이 만든 컴퓨터는 비교적 간단한 프로그램을 사용한다. 컴퓨터 프로그래머는 '코드 라인 수(lines of code)'에 대해서 이야기한다. 우리는 수학 시간에서 선(line)은 1차원이라는 것을 배웠다. 그래서 컴퓨터 프로그램은 기본적으로 1차원이다. 이에 비해 사람 유전체는 4차원으로 작동된다. 이것은 하나님의 창조적 능력이 얼마나 위대하신지를 보여주는 가장 강력한 증거 중 하나인 것이다.


1차원 : DNA 분자

사람 유전체는 약 1.8m 길이이다. 그것 전부가 미세한 세포핵 내에 들어가 있다. DNA를 사람의 머리카락 굵기로 가정한다면, DNA의 길이는 50km 이상이 될 것이며, 대략 골프공 크기 안에 들어가 있는 것이 될 것이다. 이것 하나만으로도 하나님은 경이로운 엔지니어시라는 것을 알 수 있다.

DNA에 암호로 들어있는 문자들의 순서를 나열해 놓는다면, 그것은 다음과 같이 보일 것이다 :

CTAACCCTAACCCTAACCCTAACCCTAACCCTAACCCTCTGAAAGTGGACCTATCAGCAGGATGT

GGGTGGGAGCAGATTAGAGAATAAAAGCAGACTGCCTGAGCCAGCAGTGGCAACCCAATGGGGT

CCCTTTCCATACTGTGGAAGCTTCGTTCTTTCACTCTTTGCAATAAATCTTGCTATTGCTCACTCTTT

GGGTCCACACTGCCTTTATGAGCTGTGACACTCACCGCAAAGGTCTGCAGCTTCACTCCTGAGCC

AGTGAGACCACAACCCCACCAGAAAGAAGAAACTCAGAACACATCTGAACATCAGAAGAAACAA

ACTCCGGACGCGCCACCTTTAAGAACTGTAACACTCACCGCGAGGTTCCGCGTCTTCATTCTTGA

AGTCAGTGAGACCAAGAACCCACCAATTCCAGACACACTAGGACCCTGAGACAACCCCTAGAAG

AGCACCTGGTTGATAACCCAGTTCCCATCTGGGATTTAGGGGACCTGGACAGCCCGGAAAATGAG

CTCCTCATCTCTAACCCAGTTCCCCTGTGGGGATTTAGGGGACCAGGGACAGCCCGTTGCATGA

GCCCCTGGACTCTAACCCAGTTCCCTTCTGGAATTTAGGGGCCCTGGGACAGCCCTGTACATGA

GCTCCTGGTCTGTAACACAGTTCCCCTGTGGGGATTTAGGGACTTGGGCCTT

이것은 사람 Y 염색체(human Y chromosome)의 처음 700개의 글자이다. 동일한 염기서열을 가지고 4글자를 4색의 화소(pixels)로 대체한다면, 그림 2에서 보이는 것과 같은 것을 얻게 된다.[2] 이것은 매우 인상적이지 않은가?

그림 2 : 스키틀 유전체 시각화 도구(Skittle Genome Visualization Tool)를 사용하여 보여진 사람 Y 염색체의 시작 부분. 이 그림에서 많은 반복적인 DNA 요소(줄무늬)들을 볼 수 있다. 이러한 반복은 '유전자'를 포함하지 않을 수도 있지만, 3차원 공간의 특정 위치에서 유전자들을 유지하는 역할을 한다. 커다란 검은 영역은 인간 게놈 프로젝트(human genome project)가 생략하고(skip) 넘어갔던 반복 부분이다.(그들은 아직 매우 반복적인 DNA를 시퀀스 하는 기술이 없다). 유전체의 1차원을 나타내는 4개의 글자들을 순서대로 나열해놓은 많은 정보들이 있지만, 이것은 유전체의 전체 정보에 비하면 빙산의 일각으로 매우 적은 일부분에 불과하다.


유전체의 1차원은 단순히 글자들의 순서이다. 그 글자들은 유전자들에 적혀있는 것이고, 그 유전자들은 세포가 해야 할 일을 말해주고 있다. 이것도 복잡하지만, 상황은 더욱 복잡해진다.


2차원 : 상호작용하는 네트워크

유전체의 2차원은 DNA의 한 부분이 또 다른 부분과 상호작용하는 방법과 관련되어 있다. 우리가 이미 보았듯이, 1차원은 쉽게 그릴 수 있다. 그러나 2차원을 그리려면, 먼저 DNA의 선형 문자열의 다른 부분들을 연결하는 많은 화살표들을 그릴 필요가 있다. 그러나 유전체의 전체 상호작용 네트워크를 그린다는 것은 불가능하다. 그래서 한 작은 예만을 살펴보고자 한다.


마이크로 RNA(microRNA, miRNA)는 유전자 기능의 조절에 관여하는 매우 작은(약 22개 뉴클레오티드) 분자이다. 그림 3은 동맥경화증(atherosclerosis)에 대응하여 상향 조절되고 있는, 13개의 유전자들에서 작동되고 있는 miRNA 조절 네트워크의 한 부분을 보여주고 있다. 이들 유전자들은 262개 miRNAs에 의해 표적이 되고, 372개의 '조절 관계(regulatory relationships)'를 맺고 있다. 그림 3에 포함되지 않은 33개의 다른 유전자들이 있고, 그들은 295개의 miRNAs에 의해서 신체가 이러한 상황에 처할 때 하향 조절되고 있다. 기억해야만 하는 것은, 이것은 유전체의 2차원에 대한 극히 작은 부분에 불과하다는 것이다!

그림 3 : 유전체의 2차원에 대한 좋은 예가 되고 있는 miRNA 조절 네트워크의 일부분. 그림에서 오렌지색 영역은 동맥경화증과 관련하여 262개의 miRNAs(라벨을 가진 녹색 점)에 의해서 상향 조절되고 있는 13개의 유전자들을 나타낸다. 그리고 이들 miRNAs들은 유전체의 다른 부분에서 만들어진다. (after Lin et al. 2014).[3]


유전체의 2차원은 특이성 인자(specificity factors), 증강인자(enhancers,) 억제인자(repressors), 활성인자(activators), 전사인자(transcription factors) 같은 것들과 관련되어 있다. 이들은 DNA에 암호화되어 있는 단백질들이다. 그러나 그들은 만들어진 후에 유전체의 다른 부분으로 이동하고, 어떤 것의 스위치를 켜거나 끈다. 그러나 이 차원에서 일어나는 추가적인 것들이 있다. 단백질의 제조 공정 중에, 한 유전자는 ‘전사(transcription)’라 불리는 과정 동안에 세포에 의해서 '읽혀진다'. 여기에서, DNA는 RNA라 불리는 분자에 복사된다. 그리고 RNA는 한 단백질로 번역된다. 우리는 이 과정에 대한 훌륭한 애니메이션을 가지고 있다.(multimedia site). 그러나 전사후 조절(post-transcriptional regulation)이라 불리는 과정에서, RNA가 유전체의 또 다른 부위에 코딩되어 있는 다른 인자(miRNA 같은)에 의해서 활성화되기도 하고, 불활성화 되기도 한다.


수백만 달러의 연구자금이 들어갔던 엔코드 프로젝트(ENCODE project)는 아직 완전히 이해하지는 못하고 있었던, 유전체에 관한 어떤 것들을 밝혀냈다. 가장 큰 미스터리 중 하나는 약 22,000개의 유전자들이 300,000개 이상의 서로 다른 단백질들을 어떻게 생산하는지 그 방법에 관한 것이다. 그 답은 세포가 ‘선택적 스플라이싱(alternate splicing)’이라 불리는 한 과정을 통해서 진행한다는 것이다. 그 과정에서 유전자는 잘려지고, 조각나서, 다른 부분들이, 다른 시간에, 다른 세포들에 의해서 사용되어서, 다른 환경 하에서, 많은 다른 단백질들이 만들어지는 것이다. 이 믿을 수 없도록 극도로 복잡한 과정도 유전체의 2차원에서 단지 작은 한 부분에 불과한 것이다.


3차원 : DNA의 입체 구조

각 염색체는 핵 내에서 지정된 특별한 위치에 있을 뿐만 아니라, 함께 사용되는 유전자들은 일반적으로 서로 3차원 공간에서 인접하여 발견된다. 심지어 유전자들이 서로 다른 염색체에서 발견될 때에도 그렇다!

인간 게놈 프로젝트(Human Genome Project)로 밝혀진 가장 큰 사실중 하나는, 함께 사용되는 유전자들이 유전체 내에서 반드시 서로 가까이에 위치하지는 않는다는 것이었다. 진화론자들은 ”그것은 그냥 쓰레기(junk)이다”, 또는 ”유전체는 수백만 년의 시간 동안에 일어난 유전적 사고(genetic accidents)의 축적에 불과하다”와 같은 주장들을 했었다. 그러나 이러한 주장은 오래 가지 못했다. 왜냐하면, 과학자들이 유전체가 핵 안에서 어떻게 조직화되어 있는지를 살펴보기 시작했을 때[5], 각 염색체는 핵 안에서 지정된 특별한 위치를 가지고 있을 뿐만 아니라, 함께 사용되는 유전자들은, 심지어 다른 염색체에서 발견되는 유전자들이라도 일반적으로 3차원적 공간에서 서로 서로 인접하여 발견된다는 것을 알게 되었다. 


유전체의 3차원은 DNA 분자의 모양이 다른 유전자들의 발현과 조절에 어떻게 영향을 미치는지와 관련되어 있다. 우리는 감겨진 DNA 사슬 깊이 묻혀있는 DNA 부분이 쉽게 활성화될 수 없다는 것을 알고 있다.[4] 그래서 자주 사용되는 유전자들은 일반적으로 쉽게 접근할 수 있는 위치에 있다. 따라서 하나님이 1차원적 DNA 가닥에 유전정보를 써넣으실 때에, DNA가 3차원 모양으로 접혀졌을 때에 서로 정확한 위치들에 위치하도록, 의도적으로 어떤 순서를 가지고 그것들을 써넣으셨어야만 했다. 

그림 4. 핵 내에서 사람 염색체의 3D 위치. 깊게 매립된 유전자들은 접근하기가 쉽지 않기 때문에, 염색체의 입체적(3차원) 접혀짐은 유전체의 전체 기능에 있어서 엄청나게 중요하다. (from Bolzer).[5]


4차원 : 처음의 3차원이 변경됨

유전체의 4차원은 시간(time)이 흐르면서 처음의 3차원이 변경되는 것과 관련되어 있다. 그렇다. 도저히 믿을 수 없어 보이지만, 그것이 사실이다. 모양(3차원), 상호 네트워크(2차원), 글자 순서(1차원), 모든 것들이 변경된다. 이것은 지금까지 유례가 없는 것으로, 인간이 만든 가장 최첨단 컴퓨터도 따라올 수 없는 것이다.


4차원은 여러 가지 방법으로 설명될 수 있다. 다른 간세포(liver cells)들은 다른 염색체 수를 가지고 있다는 것이 알려져 있다.[6] 이것은 간은 대사 및 해독에 관여하는 어떤 유전자의 복사본을 많이 필요로 한다는 사실에 기인한다. 간은 이들 유전자들의 많은 복사본들로 유전체를 채우는 대신에, 자신의 사용을 위한 복사본들을 만든다. 또한 다른 뇌 세포(brain cells)들은 다양한 트랜스포존(transposons)을 다른 수로, 그리고 다른 위치에 갖고 있다.[7] 진화론자들은 이들 점핑유전자(jumping genes)들을 고대 바이러스 감염으로부터 남겨진 유물로 생각했었다. 문제는 그것들이 사람 뇌의 발달에 있어서 필수적이라는 것이다. 무슨 의미인지 알겠는가? 유전체는 다이내믹하게 자신을 재프로그램 시킨다. 이것은 컴퓨터 과학자들이 오랫동안 해결하려고 애써왔던 것이다. 당신은 통제를 벗어나지 않으면서 자가-변경되는 암호를 만들 수 있겠는가? 또한 트랜스포존은 마우스의 배아 발달을 조절하는 데에 중요하다는 것이 밝혀졌다.[8] 그러한 놀라운 부분을 진화론자들은 오랫동안 '정크 DNA(쓰레기 DNA)'라 불러왔던 것이다!


결론

유전체는 극도로 복잡한 생물학적 컴퓨터(biological computer)에 내장되어 있는, 오류를 자체 수정하며, 스스로 암호를 변경하는, 다중 차원의 운영시스템이다. 거기에는 여러 중첩된(이중) DNA 암호, RNA 암호, 구조 암호들이 들어 있다. 거기에는 DNA 유전자들 및 RNA 유전자들이 들어 있다. 유전체는 그것의 구축 동안에 생물공학적 원리들을 사용하셨던, 고도의 지적 존재에 의해서, 많은 량의 여분(redundancy)들이 있도록 의도적으로 설계되었다. 그러한 여분에도 불구하고, 22,000개 정도의 단백질 암호 유전자들이 상호 협력하여, 수십만 개의 독특한 단백질들을 한 치의 오차도 없이 만들어내도록, 경이로운 수준으로 치밀하게 압축되어 있는 것이다.


나는 진화론자들에게 도전을 하나 하겠다. 유전체의 기원을 설명해보라. 찰스 다윈(Charles Darwin)은 ‘종의 기원’에서 썼다 :

”만약 다수의, 연속적인, 약간의 변경들에 의해서 형성될 수 없을 것 같은, 어떤 복잡한 기관의 존재가 입증된다면, 나의 이론은 완전히 무너질 것이다.”

나는 이 인용문이 (창조/진화 논쟁에서) 남용되고 있다는 것을 알고 있다. 그러나 잠시라도 이것에 대해서 생각해보라. 간단한 생명체는 다윈의 관점으로 설명하기에 쉬웠다. 그러나 더 복잡한 생명체에 대해서는 그 문제는 더욱 어려운 문제가 되고 있다. 유전체는 앞에서 살펴본 것처럼, 극도로 초고도로 복잡하다. 이것은 진화론자들을 매우 불편하게 만들고 있는 것이다.


유전체는 알려진 자연적 과정을 통해서는 절대로 생겨날 수 없다고 나는 생각한다. 이 도전에 응전하기를 원하는 진화론자는 정보 변경의 원인, 필요한 돌연변이의 양, 필요한 선택적 힘... 등이 모두 적절한 시간에 작동되도록 하는 것 등을 포함하여, 적절한 시나리오를 우리에게 보내 달라. 진화론자들은 수십억 년이 걸린다하더라도, 무작위적인 자연적 과정은 그들이 필요로 하는 것을 만들 수 없다는 것을 발견하게 될 것이다. (참고 : DVD ‘The High Tech Cell).



Related Articles
Splicing and dicing the human genome


References and notes
1. Yan, K.-K., et al., Comparing genomes to computer operating systems in terms of the topology and evolution of their regulatory control networks. PNAS 107(20):9186-9191, 2010.
2. Seaman, J., and Sanford, J., Skittle: a 2-dimensional genome visualization tool. BMC Bioinformatics 10:452, 2009.
3. Lin, M., Zhao, W., and Weng, J., Dissecting the mechanism of carotid atherosclerosis from the perspective of regulation, International Journal of Molecular Medicine 34:1458-1466, 2014.
4. van Berkum, N.L., Hi-C: a method to study the three-dimensional architecture of genomes, Journal of Visualized Experiments 6(39):1869, 2010.
5. Bolzer, A., et al., Three-dimensional maps of all chromosomes in human male fibroblast nuclei and prometaphase rosettes, PLoS Biol 3(5):e157, 2005.
6. Duncan, A.W., et al., The ploidy conveyor of mature hepatocytes as a source of genetic variation, Nature 467:707-710, 2010.
7. Baillie, J.K., et al., Somatic retrotransposition alters the genetic landscape of the human brain, Nature 479:534-537, 2011.
8. Tomkins, J., 2012. Transposable Elements Key in Embryo Development; icr.org/article/6928, July 25, 2012.


*관련기사 : 생명체의 정보 기원, '창조주'에서 찾아야만 한다 (2016. 10. 12. 기독일보)
http://www.christiandaily.co.kr/news/72305.html


*관련 동영상 : RNA Splicing


https://www.youtube.com/watch?v=aVgwr0QpYNE

Scientists discover second, secret DNA code


https://www.youtube.com/watch?v=-o_Cj9yDrM4

DNA - God's amazing programming; evidence for his existence


https://www.youtube.com/watch?v=CBeCxKzYiIA

The Mysterious Epigenome. What lies beyond DNA.

https://www.youtube.com/watch?v=RpXs8uShFMo

생명정보의 증거 (youtube 동영상, 한글 자막)


https://www.youtube.com/watch?v=xgiullkAeeY

DNA는 왜 창조를 증거하는가? (youtube 동영상, 한글자막)


https://www.youtube.com/watch?v=F-yRL-I6Edk



번역 - 미디어위원회

링크 - http://creation.com/four-dimensional-genome

출처 - CMI, 2016. 10. 6. (GMT+10)

구분 - 5

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6468

참고 : 6207|6126|6361|6321|6389|6148|5831|6003|5836|5580|5474|6134|5883|5734|5784|5950|5558|5454|5954|5949|6286|5725|5536|5441|5105|5094|5514|3730|512|921|3935|5458|4824|5952|6243|5863|5226|4831|4315|4736|2065|6319|4998|4503|5443|6119|5969|4982|2697|5704|5251|5456|4182|4710|4366|6009|6000

생물들의 놀라운 기술과 생체모방공학 

: 이러한 기술들이 모두 우연히 생겨났을까? 

(Inspiring Life Tricks)


    이러한 기술들은 특허를 받기에 충분하다.


동물들의 놀라운 기술

사막도마뱀(desert lizard)은 발과 등을 통해 모래로부터 물을 마실 수 있다 (New Scientist. 2016. 11. 2) : ”이 무슨 기괴한 일인가? 가시 많은 사막도마뱀은 피부 전체에 나있는 그물망과 같은 빨대들을 사용하여, 물기 있는 모래에서 물을 흡수하고 있었다”고 그 기사는 말했다. 누군가는 이 아이디어로 유용한 제품을 만들 수 있을 것이다. 이 도마뱀은 ”사막에서 신선한 물을 모으는 기술에 영감을 줄 수 있다”는 것이다.


CT 스캔으로 조류의 내장형 에어컨이 발견됐다 (Science Daily. 2016. 11. 9) : 과학자들은 조류 부리에 대한 CT 스캔을 하고나서, 발견한 복잡성에 놀라고 있었다. 생체모방에 대해서 언급하지는 않았지만, 사진과 함께 그들의 흥분을 감안할 때, 그것은 논리적으로 새 부리의 기원에 관한 논란을 불러일으키고 있었다.

”새의 부리 내에서 발생하는 체온조절 과정에 대해 궁금해지면서, 우리는 국소적 기후에 의한 외측 표면의 열 손실과 적응에 중점을 두고, 일종의 열 방열기(heat radiator)로서 새 부리(bird bill)의 기능을 연구해왔었다”고 댄너(Danner)는 말했다. ”나는 컴퓨터 주변에 둘러서서, 첫 번째 스캔 작업의 결과를 깜짝 놀란 표정으로 바라보고 있었던, 처음의 연구원들을 기억한다. 고해상도의 스캔 결과는 경험 많은 조류학자들도 결코 보지 못했던, 아니 상상조차하지 못했던, 많은 구조물을 밝혀냈다. 그리고 우리는 즉각적으로 전방 비갑개(anterior conchae)의 화려한 구조의 아름다움에 빠져버렸다.”


딱따구리가 두통을 겪지 않는 이유는? (National Geographic. 2016. 11. 5) : 딱따구리(woodpecker)의 부리가 반복적으로 나무에 부딪쳐도 손상이 없는 것은, 딱따구리의 머리와 몸에 있는 특수 구조 때문이라는 것이다. 저자인 리즈 랭글리(Liz Langley)의 말에 따르면, 그것은 ”훌륭한 진화적 설계”라는 것이다. 그 설계는 지성적 인간이 모방하기에도 충분할 정도의 복잡한 설계임을 리즈도 인정하고 있었다 : ”충격을 흡수할 수 있는 딱따구리의 능력은 미식축구와 같은 운동선수에서 뇌진탕을 감소시킬 수 있는 시스템의 개발에 영감을 불어 넣고 있다.”


홍합의 능력: 연구자들은 수중 접착제를 개발했다 (Phys.org. 2016. 11. 3) : 젖은 반창고는 쉽게 떨어진다. 이에 대해 한 기자는 말했다. ”강한 접착제라도 젖었을 때는 접착력이 떨어진다. 그러나  자연에서 영감을 받은 한 연구자는 미국 해군연구국(Office of Naval Research, ONR)의 지원을 받아, 젖은 상태에서도 접착력이 있는 접착제를 개발했다.” 그는 홍합(mussels)의 비밀을 알아냈던 것이다.


곤충은 더 나은 기술의 창출 방법을 우리에게 가르쳐 줄 수 있다. (The Conversation. 2016. 11. 8) :  Predrag Slijepcevic 지에 논문을 게재한 연구자들은 환경에 해를 끼치지 않고 협력하는, 개미, 흰개미, 다른 곤충들의 원래의 진사회성(eusociality)을 연구하고 있었다. 그러나 그들의 사회성은 신분제도(caste systems), 노예 제도와 함께 잔인할 수 있다. 그는 아마도 일개미처럼 살고 싶지는 않을 것이다. 그러나 솔로몬은 ”게으른 자여 개미에게 가서 그가 하는 것을 보고 지혜를 얻으라”(잠 6:6)라고 말하고 있다.


식물들의 놀라운 기술

인공합성 잎과 실제 잎의 기공 설계의 원칙 (Phys.org. 2016. 11. 7) : 그 기사의 맨 위에 있는 왕립학회(Royal Society)가 제공한 사진은 ‘기공(stomata)’이라 불리는 식물 잎의 기체 교환 구멍의 '설계 원리'에 대한 논의로 이어지고 있었다. ”이 논문은 빛, 물, 이산화탄소 이용률과 같은 환경요인들과 기공의 디자인과 관련한 식물 생산성 사이의 연관성을 이해하기 위해서, 생체모방 실험과 이론을 결합한, 기공의 기하학(stomata geometry)을 살펴보고 있었다.”


광합성 안테나 복합체에 관한 연구는 식물, 조류(algae), 박테리아가 빛을 어떻게 수확하는지를 밝혀내었다. (Phys.org. 2016. 11. 4) : 질문 - 진화론이나 지적설계가 워싱턴 대학의 과학자들에게 영감을 주었는가?

모든 숲길과 머리 위로 흔들리는 나뭇가지 아래로 걸어갈 때, 당신은 에너지를 수집하는, 세계에서 가장 효율적인 수십억 개의 시스템으로 둘러싸여 있는 것이다. 모든 나뭇잎, 풀잎, 조류 세포 안에는, 광합성 안테나 복합체(photosynthetic antenna complexes)라고 불리는 단백질 집합체와 작은 색소들이 햇빛을 포집한다.

안테나 복합체에 대한 향상된 이해는, 과학자들이 나뭇잎을 모방하여, 햇빛을 전기나 연료로 바꿀 수 있는 인공시스템을 개발하는데 도움이 될 수 있다. 또한 식물, 조류, 미생물에서의 광합성 과정을 보다 효율적으로 만들 수 있는 기반을 마련할 수 있다.

버섯으로 만들어진 의자 : 유기체 제조 산업의 미래는 어떨까?(Phys.org. 2016. 11. 14) : 균류(fungi)는 식물이 아니지만(식물의 분류 체계에 따라), 몇 가지 특징을 가지고 있다. Ecovative Systems이라는 회사는 균류 물질로 공원 벤치를 만들고 있다. ”뉴욕의 공장 위층에서 만들어진, 튼튼한 의자와 푹신한 쿠션은 균류로 만들어진 것입니다”라고 그 기사는 말한다. 장점은 무엇인가? 그들은 주형 안으로 스스로 조립되어 만들어지고, 쿠션처럼 부드럽지만, 강하고, 환경 친화적이라는 것이다. 그렇다면 과학에서 생체모방공학(biomimetics)은 좋은 것인가? 오타와 대학교 앤드류 펠링(Andrew Pelling)에게 물어보았다 :

”우리는 지금 생물학적 석기시대에 살고 있다” 그는 말했다. ”우리는 생물학이 얼마나 복잡한지를 과소평가해서는 안 된다고 생각한다. 그리고 그들의 성장과 수선을 이해하고 조절하기 전에 알아야만 하는 것들에 아직도 많은 미스터리들이 있다고 생각한다.” 펠링은 말했다. ”나에게 이것은 정말로 흥분되는 분야이다.”


세포의 놀라운 기술

규조류(diatoms)의 힘으로 센서 성능을 극적으로 향상시킨 새로운 기술(Science Daily. 2016. 11. 8) : 이 기사는 하나의 기적을 전하고 있었다. 말하자면, ”오리건 주립대학(Oregon State University)의 연구자들은 자연의 작은 기적 중 하나인 규조류와 잉크젯 프린팅 및 광센싱(optical sensing)을 결합하여, 다른 일반적인 방법보다 최대 1000만(10 million) 배나 더 민감한 감지 장치(sensing device)를 만들어내었다.”


유전물질로 만들어진 컴퓨터? 과학자들은 DNA-기반 나노와이어(DNA-based nanowires)를 사용하여, 전기를 전도시켰다.(Science Daily. 2016. 11. 9) : 실리콘 칩(silicon chips)이 이론적 한계에 다다랐다. 이제 DNA의 경이로운 구성조직에 영감을 얻을 수는 없는 것일까? ”한 가지 방법은 분자와 원자로부터 복잡한 구성요소들의 자기-조직화(self-organization)가 될 수 있다”고 그 기사는 말한다. ”과학자들은 이제 중요한 진전을 이루었다. 물리학자들은 하나의 DNA 가닥에서 독립적으로 자가 조립된, 금이 도금된 나노와이어를 통해 전류를 전달했다.”


화학자들은 자연을 모방하여 세포기관들의 집합체를 만들었다 (Science Daily. 2016. 11. 2) : 바젤 대학(University of Basel)의 과학자들은 분자 공장(molecular factories)을 발명하고자 했다. 그래서 그들은 세포가 어떻게 작동하는지 연구하고 있다. 이 기사는 세포가 '자기-조직화 (self-organization)'에 의해 그렇게 하는데, 물질에 지시를 하는 유전자 암호 내의 소프트웨어 때문이라고 말한다. 지적설계는 그들의 설명에서 분명히 나타나 있다. ”이 전략은 실제 자기조직화 방식을 뛰어 넘는 것이다. 왜냐하면 그것은 구획 사이 거리, 또는 수요에 따른 다른 위상들의 미세한 조정 같은 여러 다양한 요구들을 통합할 수 있기 때문이다.”


생물에서 영감 받은 질산염과 과염소산염 환원을 위한 철 촉매(Science Magazine. 2016. 11. 11) : 질산염(nitrates)과 과염소산염(perchlorates)은 농업에서 유용하게 사용되어왔기 때문에, 오염되어 있다. 이들 물질을 분해하는 효소에 영감을 얻은 과학자들은, 활성 부위를 모방한, 인공촉매(artificial catalyst)를 개발했다. 그 촉매는 오염물질을 분해할 때, 그 자체가 재생되고, DHMO(dihydrogen monoxide, 물)을 방출한다.


생물의 속도에서 생체전자공학 (Science Daily. 2016. 11. 2) : 세포막에서 고도로 선택적인 채널은 유럽의 과학자들에게 영감을 주었다 : ”유기 전자부품으로 만들어진 마이크로제조 이온 펌프”. 당신의 발가락이 무언가로부터 찔렸을 때, 신경이 얼마나 빨리 뇌로 메세지를 전달하는지를 생각해보라. 이 새로운 장치를 통해서, ”이온(ions)은 신경계의 전달 속도를 가지고, 그리도 단일 세포의 정밀도를 가지고, 신경세포 또는 근육세포로 전송될 수 있다.” 자연이 매일 하고 있는 일을 과학자들이 쫒아오는 데에 10년의 노력이 필요했다.



우리는 계속해서 독자들에게 자연의 뛰어난 기술에 영감을 얻은 '설계적 사고(design thinking)'는 과학의 미래라고 말해왔다. 자연계에서 보여지는 설계들을 연구하고, 이해하고, 모방하는 일은 지구 행성과 인류에게 유익한 열매를 맺게 해줄 것이다. 또한 생체모방공학에 관한 기사들은 생명의 기원에 대한 진화론적 주장만을 강요할 수 없게 만들고 있는 것처럼 보인다. 사람들이 모방하고 싶어할 정도의 이러한 경이로운 기술들이, 계획도 없고, 지성도 없고, 방향도 없는, 무작위적인 복제 실수로 모두 우연히 어쩌다가 생겨났단 말인가? 이 분야에서 진화론은 매우 신뢰할 수 없는 이론으로 보이는 것이다.

 


*생체모방 관련 최근 기사 :

고양이 혀 원리를 로봇에 적용하면?  (2016. 11. 25. 전자신문)
http://www.etnews.com/20161124000422

스스로 깨끗함을 유지하는 자기세정 기능을 가진 연잎 (2016. 11. 22. 중앙일보)
http://www.koreadaily.com/news/read.asp?art_id=4786993

곤충이 날개짓 할 때 만드는 작은 소용돌이가 비행성능 2배 향상  (2016. 11. 10. 뉴스1)
http://news1.kr/articles/?2827317

DNA 미세로봇 개발…A,T,G,C ‘4진수’ 정보 이용 (2016. 11. 11. IT뉴스)
http://www.itnews.or.kr/?p=19994

뇌신경 모방 딥러닝 기반 인공지능 혈압측정 기술 개발 (2016. 11. 11. IT뉴스)
http://www.itnews.or.kr/?p=19970

전남도, 생체모방기술 산업화 공식 추진  (2016. 10. 24. 노컷뉴스)
http://www.nocutnews.co.kr/news/4673568

찔러도 피 안나는 주사...KAIST 연구진, 홍합 모방한 생체 지혈 재료 개발 (2016. 10. 5. 조선비즈)
http://biz.chosun.com/site/data/html_dir/2016/10/06/2016100601940.html

‘거미 비단’이 섬유혁명 일으킨다. (2016. 8. 9. Science Time)
http://www.sciencetimes.co.kr/?news=거미-비단이-섬유혁명-일으킨다

갯가재에서 영감 얻은 초강력 소재 (2016. 7. 11. Science Time)
http://www.sciencetimes.co.kr/?news=갯가재에서-영감-얻은-초강력-소재

근육, 움직임까지…생체 모방 가오리 바이오 로봇 개발  (2016. 7. 8. KBS News)
http://news.kbs.co.kr/news/view.do?ncd=3308385

반딧불이 생체 모방하니, OLED 발광효율 높아졌네  (2016. 6. 8. 사이언스온)
http://scienceon.hani.co.kr/406671?_fr=mb2

사하라 사막에서 채소를 기르는 방법 (2016. 5. 20. 뉴스토마토)
http://www.newstomato.com/readNews.aspx?no=656441

생체모방 기획전 ‘생물로부터 배운다’ (2016. 5. 17. 에코타임스)
http://www.ecotiger.co.kr/news/articleView.html?idxno=17162

성게 이빨 모방한 우주탐사장비 (2016. 5. 16. Science Time)
http://www.sciencetimes.co.kr/?news=성게-이빨-모방한-우주탐사장비

게코도마뱀 모방 전도성 접착패드로 생체정보 측정  (2016. 3. 28. Science Time)
http://www.sciencetimes.co.kr/?news=게코도마뱀-모방-전도성-접착패드로-생체정보-측정

바다오리 모방한 비행잠수로봇 (2015. 12. 8. Science Time)
http://www.sciencetimes.co.kr/?news=바다오리-모방한-비행잠수로봇

서울대-LG전자, 혹등고래 등 생체모방 기술로 고효율 팬 개발(2015. 11. 5. 전자신문)
http://www.etnews.com/20151105000057



번역 - 미디어위원회

링크 - http://crev.info/2016/11/inspiring-life-tricks/

출처 - CEH, 2016. 11. 14.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6494


참고 : 6199|5960|5932|5926|5894|5856|5694|5689|5671|5656|5600|5596|5567|6162|5997|5551|5504|5430|5426|5352|5351|5287|5142|5088|4764|4728|4041|6492|6475|6406|6336|6324|6308|6304|6302|6291|6290|6289|6272|6245|6178|6165|6163|6160|6159|6137|6069|6034|6023|6001|5976|5975|5962|5959|5934|5920|5438|5902|5899|5896|6402|6391|6309|6269|6236|6200|6114|6057|6056|6053|6050|5978|5956|5938|5933|5855|5823|5788|5778|5774|5772|5763|5757|5754

David F. Coppedge
2019-05-02

암호는 저절로 우연히 생겨날 수 없다

 : 생명체에 들어있는 유전정보는 진화론을 부정한다.

(Codes Cannot Create Themselves)

David F. Coppedge

      암호(code)를 작성하려면 먼저 마음(mind)으로부터 시작해야 한다. 그런 다음 암호를 알고 있는 발신자와 수신자를 설계해야 한다.


과학자들도 생물학적 암호가 실제적이고, 어디에나 보편적으로 존재하고 있다는 것을 인정하고 있다. 시생대의 가장 단순한 미생물에서부터, 가장 복잡한 포유동물에 이르기까지, 생물들은 발신자와 수신자간에 전달되는 암호로 된 유전정보들로 가득하다. 와일더 스미스(A.E. Wilder-Smith) 박사는 암호는 그 자체만으로는 의미가 없다는 점을 강조했었다. 발신자와 수신자가 모두 암호에 대한 언어 규칙을 이해할 때만 의미가 있는 것이다.


Biosystems 지의 특별 주제로 다룬 암호생물학(Code Biology) 논문들에서, 유물론적 진화론자들은 생명체의 시작 이전에 암호의 기원을 어떻게든 설명해보려고 시도하고 있었다. 기억해야할 것은, "자연선택(natural selection)"은 유전자 시스템에서 정확한 복제가 이루어지기 전까지는 작동될 수 없다는 것이다. 왜냐하면 자연선택은 자손에게 어떤 유익한 특성을 암호로 전달할 수 없다면, 작동되지 않을 것이기 때문이다. 자연선택을 말하면서, 생명체에 들어있는 암호가 저절로 우연히 만들어졌을 것이라는 믿음은 기적을 믿는 것과 같은 것이다.


RNA 세계(RNA world)에서 초기에 나타나야하는 극복하기 어려운 유전암호 문제.(Wills & Carter, Biosystems). 이것은 아마도 ‘생물학적 정보의 기원’에 있어서 가장 대중적인 이론인 진화론에 대한 최고의 명연설(show-stopper)일 것이다. 윌스와 크레이터(Wills & Carter)는 오류의 재앙이 RNA World와 같은 상향식(bottom-up) 이론을 망칠 것이라는 것을 잘 알고 있었다. 그들은 다윈의 자연선택을 초월하는 원리가 요구된다는 것을 깨닫고 있었다. 그러므로 하나님이 그것에 대한 논리적 결론일 것이다. 그러나 대신에 그들은 어떻게든 "자기조직화(self-organization)"가 신속하게, 견고한, 일치된 암호 시스템을 만들어낼 수 있었다는 믿음의 도약을 하고 있었다. 이것은 기적을 믿는 것과 다름이 없다.

암호화된 단백질 합성의 출현을 설명하기 위해서, 자기촉매 이론(theory of autocatalysis) 내에서 오류가 발생하기 쉬운 정보 전달(복제, 전사, 또는 번역)을 위한 미분방정식이 개발되었다. 여러 방정식들은 궁극적으로는 효소들에 의한 특정 tRNA 아미노산화 출현에 대한 시나리오들의 타당성을 비교해볼 수 있는, 그리고 센트럴 도그마(Central Dogma, 유전정보의 흐름을 나타내는 분자생물학의 기본 원리) 내에 들어있는 분자생물학적 정보를 처리하는 보편적 시스템의 기원과 이 과정의 관계를 비교해볼 수 있는, 하나의 기초를 제공하고 있다. 가설적인 RNA 세계는 이 시스템이 어떻게 생겨났는지 설명할 수 있는 적절한 근거를 제공하지는 못하지만, 다윈의 자연선택을 초월하는 자기조직화 원리는 펩타이드-RNA 세계의 유전자 암호의 신속하고 일치된 전환을 위한 예상치 못했던 견고한 기초를 제공하고 있다.

원인, 생성자, 그리고 암호.(Hofmeyr, Biosystems). "형상인(formal cause)"은 청사진이나 무언가를 위한 계획이다. "작용인(efficient cause)"은 그것을 초래하는 것이다. "보편적 생성자(universal constructor)"는 끝없이 스스로 재생성 되는, 그러한 기계에 대한 요구사항에 주의를 환기시키는, 폰 노이만(Bon Neumann)의 이론적 실체이다.

관계 생물학(relational biology)은 아리스토텔레스의 4 원인론(Aristotle’s four causes)에 대한 로버트 로젠(Robert Rosen)의 공식화를 가능하게 만들었던, 인과관계의 함의에 대한 풍부한 이해에 크게 의존하고 있다. 현재까지 작용인과 목적인(final cause)의 회복이 주요 초점이었다. 형상인은 별로 중요하게 여겨지지 않았다. 그러나 이 논문이 보여주듯이, 생물학적 과정은 아니지만, 여러 유형의 과정들을 이해하는데 있어서 그것은 중요하다. 매핑(mapping)의 그래프 이론적 관계 다이어그램은 관계생물학에서 중요한 역할을 해왔으며, 이 논문의 첫 번째 부분은 다이어그램에서 형상인을 명시적으로 표현하는 방법의 발달에 기여하고 있었고, 그것이 매핑을 형성하기 위해서 작용인과 어떻게 함께 작용하는지를 설명하고 있다. 


언어의 진화적 동력학.(Luc Steels, Szathmáry Eörs, Biosystems). 이 논문은 자기 비판을 하고 있다. 진실과 연결되어 있지 않는다면, 언어는 의미가 없다.

진화론적 동력학의 잘 확립된 틀은 인간의 뇌가 언어(language)를 습득하고 적응할 수 있는 방법과, 언어가 집단 내에서 어떻게 변하는 지에 대한 매혹적인 문제에 적용될 수 있다. 문법적 구조를 다루는 틀은 복제되고 있는 단위이다. 언어는 개인의 두뇌 변화에 따라 출현하고 증식하며, 필요한 표현력, 성공적 의사소통, 적은 인지 노력 등에 대한 기여도를 토대로 선택된다. 이 관점을 채택하는 데에는 두 가지 큰 이점이 있다. (i)진화론적 동력학의 관점에서 적응된 뇌의 신경생물학 모델과 연결된다. 따라서 인간의 뇌가 언어를 구사하는 현저하게 복잡한 능력을 어떻게 얻었는지에 대한 새로운 지평을 열게 된다. 그리고 (ii)진화적 동력학적 과정으로서, 문화적 언어 변화를 연구하기위한 새로운 토대를 제시한다. 이 논문은 이러한 새로운 시각을 소개하고, 경험적 데이터와 계산된 실험에 대한 레퍼런스를 제공하며, 공개된 문제들을 지적하고 있다.

유기촉매 바이트에서 정보의 운반 : 반-생성(Semiopoiesis): 생명의 기원에 대한 새로운 이론. (Dos Santos, Biosystems). 이 과학자들은 암호 정보와 분자 정보를 비교하고 있었다. 이것은 카테고리 분류의 실수이다. 분자에서 그들의 순서는 특성을 나타내는 것이지, 정보를 운반하지 않는다. 유전학에서 염기서열은 중요한 부분이다. 그것은 기호학적(기호에 기초한) 유전정보를 전달하고 있다. 도스 산토스(Dos Santos)는 "유기촉매(organocatalysts)"가 분자들을 정보를 전달하는 유전적 생체고분자로 바꾸어줄 수도 있었을 것으로 추정하고 있었다. 그러나 그러한 일은 일어나지 않을 것이다. 자석에 의해 끌어당겨진 철자들의 무작위적 수집으로 의미가 통하는 문장이 만들어질 수 있을까? 산토스는 또한 "자연선택에 의해 진화할 수 있는" 시스템과 생명체를 혼동하고 있었다. 생명체는 우연히 발생할 수 없어 보인다!

살아있는 생명체는 반복적으로 구성요소들을 생성하며, 경계가 유지될 수 있는 화학적 시스템이며, 자동 복제되는 기계로서 고전적으로 묘사되어 왔다. 반면에, 매우 간단한 자기생산적 미셀(autopoietic micelles)이 실험실에서 생산되었다. 그것들은 자신의 계면활성제의 생산을 촉매할 수 있는 미셀(micelles, 작은 분자의 응집에 의해서 형성된 교질입자)로 구성되어있다. 그러나 이러한 자가생성 시스템이 진화할 수 없다는 것은 매우 분명하다. 이런 방식으로 이들 자기생산 미셀들이 항상 진화적 관계로 연결되어 있는, 살아있는 생명체와 관련될 수 없다. 여기서 나는 살아있는 생명체는 분자 정보를 보존할 수 있는, 자기생산적 시스템의 한 종류라고 주장한다. 그 특성은 반-생성(semiopoiesis)이라는 용어로 표현될 수 있다. 그들의 생성물에 대한 분자적 정보를 정의함으로써, 반-생성 시스템은 미디움(medium)과의 상호작용을 제어하고, 조직 유지에 유익한 분자 정보를 자손에게 전달할 수 있기 때문에, 반-생성 시스템은 자연선택에 의해서 진화할 수 있었다. 정보는 일련의 상태 또는 명령들을 갖고 있는 특별한 모양 또는 순서로 말해질 수 있다. 따라서 핵산의 뉴클레오타이드 서열과 같은, 또는 단백질의 아미노산 서열과 같은 분자 정보(molecular information)는 구성 요소들의 배열을 지시하고 있는 특별한 명령이다. 그러나 분자 정보는 뉴클레오타이드 서열에만 국한되지 않는다. 작은 유기화합물의 원자들 또한 다양한 순서를 나타낼 수 있어서, 여러 이성질체(isomers)들이 만들어진다. 서로 다른 이성질체는 매우 다른 화학적 및 물리적 특성을 나타낼 수 있어서, 유기화합물의 생화학적 생물리적 특성은 그것의 조성 및 분자 정보에 의해서, 즉 이들의 원자가 배치되는 특정한 위치에 의해서 결정된다. 이 분자 정보는 선택적 유기촉매(organocatalysts)에 의해서 촉진되는 반응 동안에 보존될 수 있었다. 이러한 방식으로, 생체고분자를 기반으로 한 시스템이 출현하기 이전까지, 유기촉매는 유전정보를 전달하는 원시 매개체의 설득력 있는 후보자가 될 수 있다. 추정되는 유기촉매에 기반한 기초적인 진화가 논의되었다. 마지막으로 필자는 유기촉매 미셀이 관련 산업에 영향을 미치는 프로그램 가능 물질, 인공 광합성, 자가-건설 물질, 인공생명체와 같은 것들을 만들어내기 위해서 설계될 수 있다고 주장한다.

----------------------------------------------------


유물론자들이여, 당신들은 무작위적 과정으로 여기에 있는 것이 아니다. 지성이 없는 분자들은 암호를 만들지 않는다. 그것은 프로그래밍을 필요로 한다. 분자와 생물체 모두 이해할 수 있는 지성과 목표를 가진 누군가가 있어야 한다. 지성이 없는 기호는 무의미하다. 지성을 가진 한 창조자만이 임의의 기호를 선택하여, 의미를 부여할 수 있으며, 그 기호를 해석하고 반응할 수 있는 기계들을 만들 수 있다. 기호 자체, 또는 기호 집합은 아무 것도 할 수 없다. 다른 분자들과 충돌하여 "ATG"라는 뉴클레오타이드가 결합될 수는 있겠지만, 그것이 메티오닌을 만들어낼 수는 없다. 그리고 또 다른 뉴클레오타이드와 결합하여 다른 아미노산 분자들을 만들어내고, 정확한 순서대로 결합시킬 수는 없다. 그것도 모두 L-형 아미노산들로 말이다. 하나의 단백질을 만드는데 필요한 수백 개의 코돈(codon)들이 우연히 만들어질 가능성은 없어 보인다.


박사 학위가 있는 사람이라 하더라도, 지성 없이 생명의 기원을 설명하려는 시도는 우스꽝스러운 것이다. 지성 없이 암호가 만들어질 수 있는 방법은 없다. 모든 유전정보들이 모두 우연히 생겨났다는 주장은 정말로 어리석은 주장이다. 지적설계를 배제하고 생명의 기원을 설명할 수 있는 방법은 없어 보인다. 생물들은 막대한 량의 암호화된 정보로 가득하다. 그 문제를 살펴보고 있는 Biosystems 지의 이번 특별 호를 보게 되어 기쁘다. 그러나 진화과학자들이 살아있는 생명체에서 관측되는 명백한 의미를 무시하고 있다는 것은 실망스러운 일이다.


CEH, 2019. 3. 13.

https://crev.info/2019/03/codes-cannot-create-themselves/

번역 : 미디어위원회


*관련 글 

Brian Thomas
2019-04-17

춤을 추고 있는 세포의 소기관들 

: 세포의 초고도 복잡성이 계속 밝혀지고 있다.
(Dances with Cells)

Brian Thomas

      세포생물학자들은 오랫동안 가장 작은 상호작용(interactions)들에 대해서, 즉 분자들 사이에서 일어나는 상호작용들에 대해 집중해왔다. 최근에 일부 연구자들은 새로운 기술을 사용하여, 세포소기관(organelles)이라고 불리는, 세포의 구획(compartments)에서 무슨 일이 일어나고 있는지를 일부 들여다볼 수 있었다. 그들의 발견은 질병에 대한 새로운 통찰력을 제공하고 있으며, 표준 교과서에 그려져 있는 모든 세포 그림들을 다시 그리도록 만들고 있었고, 세포(cells)를 원형질의 단순한 덩어리(simple blobs of protoplasm)라고 생각하는 사람들에게 커다란 도전이 되고 있었다.

Nature 지는 새로운 연구 결과에 대한 특집 기사를 실었다.[1] 이 기사는 새로운 수업인 것처럼 보인다. 기사에 의하면, 세포소기관(organelles)들은 정교한 방식으로 상호 연결되어 있다는 것이다. 그들은 격리된 구획으로 작동하는 것이 아니라, 둘레가 포장되어 있고, 서로가 서로에 대해 고정되어 있었다. 그리고 그들의 근접은 우연이 아니다.

세포소기관들의 복잡한 배열에 의한 상호연결은 소포체(endoplasmic reticulum)가 미토콘드리아 주위에 역동적으로 접혀져있는 방식을 포함하고 있다. 이렇게 하면(오직 이 방식만), 칼슘, 지질, 당류와 같은 생성물을 잘 교환할 수 있으며, 충분히 빨라서, 세포를 건강하게 유지시킬 수 있는 것이다.

추가 연구에 따르면, 소수의 세포소기관들 사이에 슈퍼-접촉 영역(super-contact zones)이 있음이 밝혀졌다. 이 영역에는 특별한 테더(밧줄, 사슬) 단백질(tether proteins)들이 사용된다.[1] 노스웨스턴 대학의 세포생물학자인 로라 랙크너(Laura Lackner)는 Nature 지에서 다음과 같이 말했다. ”그것은 완전히 다른 차원의 공간적 조직체를 만들어낸다.”[1]

세포는 이미 그들의 DNA 염기서열에서, 이 세상에서 가장 높은 밀도로 압축된 암호화된 언어를 갖고 있으며, 유전적 암호와 후성유전학적 암호들의 배열에 있어서 최고 수준이며, 심지어 염색체 구조의 배열에 있어서도 최고를 자랑한다.[3] 이제 여기에 이러한 복잡성도 추가되게 된 것이다.

일부 세포소기관들은 이들 과학자들의 눈에 마치 춤을 추는 것처럼 운동을 하며, 접촉하고, 분리되고, 다시 만나고 있었다. 병에 걸린 세포는 불균형한 접촉 패턴을 보여주고 있었다. 하버드 대학의 Gökhan Hotamıȿlıgil은 Nature 지에서 ”그것은 매우 우아해 보이지는 않는다”고 말했다. 그러나 콜로라도 대학의 세포생물학자인 기아 볼츠(Gia Voeltz) 교수는, 건강한 세포소기관들이 동료들과 춤을 추고 있는 현미경 영상을 보여주었다. 그녀는 말했다. ”나는 모든 것들이 그렇게 상호 연결되어 있다는 것을 몰랐다. 그것은 너무도 아름답다.”[1]

2017년으로 돌아가서, 미국에 기반을 둔 한 팀의 세포생물학자들은 6개의 개별적으로 색깔을 띤 세포소기관들에 대한 영상을 소개했다.[4] 여기에서 역동적으로 움직이고 있는 이들의 춤을 엿볼 수 있었다.(아래 References 5번 링크 클릭).[5] 이러한 것들은 어디에서 왔을까?

바이츠만 연구소(Wiezmann Institute)의 생물학자인 마야 슐디너(Maya Schuldiner)는 의도하지 않게 그것에 대한 한 대답을 하고 있었다. 그녀는 Nature 지에서 말했다. ”세포소기관들은 고립되어서는 기능을 할 수 없다.”[1]. 이는 필요한 세포소기관들(아마도 모든 세포소기관들)이 그들을 묶고 있는 테더 단백질(tether proteins)들과 동시에 발생했음을 의미한다.

자동차 엔진이 그러한 상황에 대한 적절한 설명이 될 수 있을 것이다. 피스톤, 점화 플러그, 라디에이터와 같은, 필요한 엔진 부품들이 모두 있어야하고, 그들이 올바른 위치에 배치되어 있어야할 뿐만 아니라, 모든 부품들이 단단히 고정되어 있지 않다면, 그것은 고철더미에 불과할 것이다. 그래서 생명체인 세포가 작동되기 위해서는, 세포소기관들이 모두 함께 작동되어야 하는 것이다. 그러나 이들 세포의 엔진 부품들은 서로 붙어있지 않다. 그들은 안무 리듬에 따라 함께 미끄러지며, 접촉과 분리를 진행하는 것이다.

이러한 새로운 ”전부 아니면 무(all-or-nothing)”인 기관의 발견은 그 기원이 창조임을 가리킨다. 이러한 기관은 부품들이 하나씩 하나씩 생겨나는 점진적인 과정을 통해 만들어질 수 없다. 캘리포니아 데이비스 대학의 생물학자인 조디 눈나리(Jodi Nunnari)는 Nature 지에서 말했다. ”이와 같은 종류의 기능적 허브(functional hub)는 세포가 창조된 것처럼 보이게 만든다”고 말했다. 세포가 자동차 엔진 보다 복잡한 이러한 자신의 부품들을 만들어내는 것을 본 사람은 아무도 없다. 세포 안에서 일어나고 있는 이러한 함께 추는 춤은 초자연적 기원을 가리키는 것이다.



References
1. Dolgin, E. 2019. How secret conversations inside cells are transforming biology. Nature. 567(7747): 162-164.
2. Tomkins, J. Epigenetic Code More Complicated Than Previously Thought. Creation Science Update. Posted on ICR.org January 28, 2016, accessed March 29, 2019.
3. Thomas, B. Genomes Have Remarkable 3-D Organization. Creation Science Update. Posted on ICR.org November 15, 2010, accessed March 29, 2019.
4. Valm, A. M. et al. 2017. Applying systems-level spectral imaging and analysis to reveal the organelle interactome. Nature. 546 (7656): 162-167.
5. Valm, A. M. et al. 2017. Supplementary information. Video 1: Point-scanning confocal, 6-colour time-lapse images. Nature. 546 (7656): 162-167.

*Dr. Thomas is Science Writer at the Institute for Creation Research and earned his Ph.D. in paleobiochemistry from the University of Liverpool.


출처 : ICR, 2019. 4. 9.
URL : https://www.icr.org/article/11268/
번역자 : 미디어위원회


Frank Sherwin
2019-04-13

놀랍고, 독특하고, 진정 기괴한 옐로스톤의 미생물 

(Incredible, Unique, and Truly Weird' Yellowstone Microbes)

Frank Sherwin 


       수십 년 동안 옐로스톤 국립공원(Yellowstone National Park)의 뜨거운 온천에는 고균(Archaea)이라 불리는 특별하고 견고한 원핵미생물 유형이 살고 있는 것으로 알려져 왔다. 고세균(archaebacteria)으로 알려진 이들 미생물에는 메탄생성균(methanogens), 극도의 호열균(thermophiles, 열에 잘 견디는 유기체), 극도의 호염균(halophiles, 성장에 소금을 필요로 하는 유기체) 등이 포함된다. 고온성 고세균의 한 종은 유황이 풍부하고, 끓는 물에서도 살아갈 수 있는 술포로부스(Sulfolobus) 균이다. 그들은 극한의 환경에서도 고도로 저항할 수 있도록 설계되었는데, 진화론자들은 그들이 지구의 첫 번째 생명체 형태가 됐을 수도 있다고 제안하고 있다.









창조과학자들은 이 '진정 기괴한' 미생물의 발견을 축하하지만, 그 발견은 진화론과는 아무런 관련이 없다.

최근에 ”믿을 수 없도록 놀랍고, 독특한, 그리고 진정 기괴한” 미생물 집단이 옐로스톤의 높은 고도에서 발견되었다. 창조과학자들은 이 ”진정 기괴한” 미생물의 발견을 축하하지만, 그 발견은 진화론과는 아무런 관련이 없는 것이다. 그러한 극도의 열악한 환경에서도 견디며 살아갈 수 있는 놀라운 미생물 집단의 발견은 창조주의 경이로운 설계를 보여주는 것이다. 이러한 고도의 설계로 인해, 그 미생물들은 서식하기 어려운 열악한 환경도 채울 수 있는 능력을 갖고 있는 것이다. 실제로 고세균은 그들의 세포막에 지방산이 없다는 점에서 전형적인 '박테리아'와 다르다. 대신, 그들은 크렌아케올(crenarchaeol)이라 불리는 독특한 지질을 갖고 있다. 또한 RNA 중합효소(RNA polymerase)라 불리는 단일 유형의 효소를 가진 박테리아와는 달리, 고세균에는 더 복잡한 여러 종류의 효소들을 갖고 있다.

그 기사는 ”어떤 것들은 고대 미생물의 현대적 친척이 될 수도 있으며, 초기 지구의 생명체와 다른 행성에서의 생명체에 대한 잠재적 교훈을 제공할 수도 있다”고 말했다.[1] 여기 지구의 과거와 현재에 내열성 박테리아(호열균)가 존재한다는 것이 화성과 같은 가혹한 환경의 다른 행성에서도 비생명체로부터 생명체가 진화했을 수도 있다는 결론과는 거리가 먼 것이다. 화성의 환경은 너무도 가혹하기 때문에, 화성에서 고온에 견디는 호열성 세균이 진화했을 수도 있다는 주장은 설득력이 있는 것일까?

그 기사는 더 나아가 이렇게 쓰고 있었다 :

그러한 시스템과 그 안에 살아가는 흥미로운 유기체에 대한 추가적인 연구는 미생물 생태계에 대한 중요한 추가적인 통찰력을 제공하고, 생화학적 과정의 진화에 있어서 그들의 역할에 대해 새로운 빛을 비춰줄 것으로 보인다.[1, 2]

창조과학자들은 이 독특한 미생물에 대한 연구가 미생물 생태계 분야를 더 잘 이해할 수 있게 도와줄 것이라는 것에는 동의한다. 그러나 세속적 생물학자들에게 이들 흥미로운 미생물의 생화학적 과정에 대한 진화 연구는 새로운 빛이 아니라, 해로운 광선이 될 것이다.

... 핵심 물질대사와 심지어 중간 물질대사를 포함하는 그들의 경로(과정)의 출현은 특히 수수께끼이다.[3]

옐로스톤(Yellowstone)에 있는 이들 ”믿을 수 없도록 놀랍고, 독특하며, 진정 기괴한” 미생물 집단에 관해 앞으로 많은 사실들이 밝혀질 것이다. 그들은 수천 년 전에 다른 모든 박테리아들과 함께 유사한 형태로 창조된 것이다.



References
1. 'Incredibly' diverse microbial community high in Yellowstone. Sciencedaily. Posted on sciencedaily.com February 27, 2019, accessed March 5, 2019.
2. Colman, D. R., M. R. Lindsay, E. S. Boyd. 2019. Mixing of meteoric and geothermal fluids supports hyperdiverse chemosynthetic hydrothermal communities. Nature Communications. 10:681.
 3. Noda-Garcia, et al. 2018. Metabolite-enzyme coevolution. Annual Review of Biochemistry. 189.

*Mr. Sherwin is Research Associate at ICR. He has a master’s in zoology from the University of Northern Colorado. 



출처 : ICR, 2019. 3. 26.
URL : https://www.icr.org/article/truly-weird-yellowstone-microbes/
번역자 : 미디어위원회

Frank Sherwin
2019-03-29

계속 밝혀지고 있는 광합성의 경이로운 복잡성 

(Photosynthesis Continues to Amaze)


     하나님이 창조하셨던 가장 복잡한 생화학적 과정 중 하나는 식물이 이산화탄소와 물을 섭취하고, 햇빛을 사용하여, 그것을 에너지가 풍부한 당(sugars)으로 전환시키는 능력이다. 우리들은 학교에서 광합성(photosynthesis)이라는 놀라운 과정에 대해서 들어보았을 것이다. 그것은 사실상 지구 생태계로 들어오는 에너지를 이용하는 경로가 되도록 설계된 것이다. 당신이 광합성을 연구했다면, 그 과정이 얼마나 경이로운 것인지를 알 수 있다! 너무도 경이로워서 과학자들에게 여전히 미스터리가 되고 있다.

광합성은 아마도 지구상에서 가장 중요한 생화학적 과정일 것이고, 과학자들은 아직도 그것이 어떻게 작동되는지 완전히 이해하지 못하고 있다.[1]

식물 세포에서 광합성이 일어나는 부위는 엽록체(chloroplasts)라 불리는, 기관과 같은 구조(organelles, 세포소기관)이다. 이들 구조는 엽록소(chlorophyll, 빛을 포획하는 주요 색소)라 불리는 화학물질을 포함하고 있다. 하나님은 광합성 과정이 두 단계로 진행되도록 설계하셨다.

1. ATP(에너지)와 NADP(전자 운반체)를 생성하는 빛 포획(light-trapping) 단계 (명반응).

2. 당을 생산하는 광과 무관한 단계(암반응). 흥미롭게도 광합성 과정에서 발생하는 폐기물 중 하나는 산소이다.

진화론자들에게 심각한 문제는 수십억 년 전의 지구상 최초 생명체 중 하나도 광합성을 하고 있었다는 것이다. 물론 확실히 말할 수는 없다. 왜냐하면 최초 광합성 생명체가 있었다는 다윈의 '따뜻한 작은 연못'에 대한 모든 증거는 존재하지 않기 때문이다. 진화론자들은 이 초고도로 복잡한 과정이 34억 년 전에 우연히 자발적으로 시작되었다는 가설과 추측만을 제시하고 있다.[2]

최근 로렌스 버클리 국립연구소(Lawrence Berkeley National Laboratory)의 과학자들은 광합성에 결정적으로 중요한 커다란 단백질 효소 복합체(protein enzyme complex)를 발견했다.[3] 햇빛 에너지를 매개로 하여 에너지가 풍부한 전자(electrons)는, 시토크롬, 철–황 단백질(iron-sulphur proteins), 퀴논, 기타 화합물을 포함하는 전자전달계(electron transport chain or system)로 불리는 것 내에 있는, 여러 단백질 복합체 사이에서 왕복한다. 이제 과학자들은 세계에서 가장 발달된 현미경 중 하나를 사용하여, 이 복잡한 기능이 어떻게 작용하는지를 조사하였다. 그 과정은 극도로 정교하고 복잡했다. 이 복합체는 NADH라고 불리며, 수십 년 동안 알려져 왔었지만, 과학자들은 이들 원자들이 중요한 광합성 기능을 수행하기 위해서, 어떻게 배열(연결)되어 있는지를 보여주는 분자적 청사진(molecular blueprint)을 결코 얻지 못했었다. 생물물리학자인 카렌 데이비스(Karen Davies)는 말했다 :

이 효소에 대한 지난 20년 간의 연구는 어려웠고, 혼란스러웠다. 왜냐하면 그 효소의 NADH 구조에 대한 정보는 매우 부족했기 때문이다.[3]

21세기의 뛰어난 과학자들은 원자 수준에서 광합성의 복잡한 세부적 사항을 밝혀내기 위해서 최고의 장비와 수백만 달러의 연구비를 사용하고 있다. 광합성이 기능하기 위해 필요한 모든 원자들은 이 복합체에 정확히 배치되어 있었다. 이것은 원자들이 우연히 어쩌다가 배치되었다고 보기보다, 정밀하게 설계되어 배치되었음을 가리킨다.

광합성이 수십억 년 전에 무작위적인 사건으로 우연히 어쩌다가 발생했을까? 아니면 목적과 계획과 설계에 대한 분명한 증거인가?

”창세로부터 그의 보이지 아니하는 것들 곧 그의 영원하신 능력과 신성이 그가 만드신 만물에 분명히 보여 알려졌나니 그러므로 그들이 핑계하지 못할지니라” (로마서 1:20).



References
1. Deep within spinach leaves, vibrations enhance efficiency of photosynthesisMichigan News. Posted on unmich.edu on July 13, 2014, accessed February 17, 2019.
2. Howard, V. 2018. Photosynthesis Originated A Billion Years Earlier Than We Thought, Study Shows. Astrobiology Magazine. March 7, 2018.
3. New molecular blueprint advances our understanding of photosynthesis. PhysOrg. Posted on Phys.org Feb. 15, 2019, accessed Feb. 20, 2019.

*Mr. Sherwin is Research Associate is at ICR. He earned his master’s in zoology from the University of Northern Colorado.



번역 - 미디어위원회

링크 - https://www.icr.org/article/11248/

출처 - ICR, 2019. 3. 14.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=7019


참고 : 

1. 광합성의 양자 비밀이 밝혀졌다. (Quantum Secret of Photosynthesis Revealed)

2. 식물의 광합성은 양자물리학을 이용하고 있었다. (Photosynthesis Uses Quantum Physics)

3. 녹색 파워 광합성 : 경이로운 식물의 태양광 발전소 (Green power (photosynthesis) God’s solar power plants amaze chemists)

4. 산소 발생 광합성은 생각보다 더 초기에 시작됐다. (Evolution Conspiracy: Oxygen Photosynthesis Began Earlier Than Thought)

5. 진화론자들이 자주 사용하는 말, “생각했던 것보다 일찍” : 광합성, 육상식물 등의 출현 시기는 더 내려갔다. (Most Common Phrase in Evolution Media: “Earlier Than Thought”)

6. 식물에 내장되어 있는 광합성 조절 스위치 (Plants' Built-in Photosynthesis Accelerators)

7. 광합성을 증진시키기 : 태양전지가 광흡수 면에서 식물을 이제 앞질렀다? (Improving Photosynthesis? Solar Cells Beat Plants at Harvesting Sun's Energy, for Now)

8. 식물들은 빛과 광합성을 최고 효율로 얻고 있다. (Respect Your Plant: Don’t Say it Evolved)

9. 80년 된 생명 기원의 원시 수프 이론은 폐기되고 있다. (Old Primordial Soup Is Spoiled)

10. 세포 내의 고속도로에서 화물을 운반하는 단백질 키네신 : 이 고도로 정교하고 효율적인 분자 기계가 우연히? (Molecular Highway Motor Comes into Focus)

11. 독성물질을 지닌 혜성이 지구에 생명을 실어 날랐다? : 포름알데히드가 생명체의 기원? (Poison Comets Brought Life to Earth)

12. 복잡한 세포는 박테리아로부터 진화될 수 없었다. (Study Demonstrates Complex Cells Could Not Evolve from Bacteria)

13. 세포의 기원 연구는 잘못된 과학을 사용하고 있다. (Origin of Cells Study Uses Bad Science)

14. 식물의 단백질 상호작용에 대한 가장 큰 유전자 지도가 작성되었다. (Largest-Ever Map of Plant Protein Interactions)

15. 최초의 세포가 우연히 만들어질 가능성은 더욱 낮아졌다. (First Cell's Survival Odds Not in Evolution's Favor)

16. 생명의 기원에 관한 새로운 이론 : 해저 사문암 공극에서 우연히 자연발생? (New Life Origins Theory Has Old Problems)

17. 바이러스가 도약하여 최초의 세포가 될 수 있었을까? (Could a Virus Jump-Start the First Cell?)

18. 고도로 복잡한 단백질 모터는 진화를 부정한다. (Sophisticated Protein Motor Defies Evolution)

19. 한 외과의사가 진화론을 해부하다. : 생명체의 자연발생은 불가능하다. (Baylor Surgeon 'Dissects' Darwinism)

20. 진화의 증거는 단지 가정된 것임을 실험 연구는 보여준다. : 단백질은 조금씩의 변화로 다른 단백질이 될 수 없다. (Lab Studies Show Evolutionary 'Evidence' Is Merely Assumed)

21. 해결되지 않고 있는 L-형 아미노산 문제 (Left-Handed Amino Acid Puzzle Remains)

22. 책으로 700억 권에 해당하는 막대한 량의 정보가 1g의 DNA에 저장될 수 있다. (Scientists Store 70 Billion Books on DNA)

23. ‘엔코드’ 연구로 밝혀진 유전체의 초고도 복잡성. : ‘정크 DNA’ 개념의 완전한 몰락 (ENCODE Reveals Incredible Genome Complexity and Function)

24. 화학진화는 사실인가? : 생명체의 자연발생설은 부정된 이론이다. (Is chemical evolution true?)

25. 단백질이 진화될 수 없음을 밝힌 한 새로운 연구 : 단백질은 돌연변이들로 개선될 수 없다. (Study Shows Proteins Cannot Evolve)

26. 유전 정보의 기원은 무엇인가? : 과학자들이 생명의 기원을 찾는 새로운 방법을 제안하다. (ASU researchers propose new way to look at the dawn of life)

27. 창조론에 가까운 생명의 기원에 관한 진화 연구. (Evolution of Life Research Close to Creation)

28. 진화론자들의 글에서 감지되는 공황 상태 : 생명체는 차가운 얼음 바닷물에서 출현했을 수도 있다? (Detecting Panic in Evolution Articles)

29. 브롬이 없다면, 생물들은 존재할 수 없었다. : 생명체가 존재하기 위한 필수적 원소는 28개 (Without Bromine, There Would Be No Animals)

30. 선도적 과학자들이 진화론을 비판하다. 1부. : 유전정보는 자연주의적 과정으로 생겨날 수 없다. (Powerhouse of Scientists Refute Evolution, Part One)

31. 선도적 과학자들이 진화론을 비판하다. 2부. : 생물학적 정보 생성의 어려움과 컴퓨터 시뮬레이션 (Powerhouse of Scientists Refute Evolution, Part Two)

32. '생명의 기원' 논란의 종지부 : 산소는 처음부터 있었다. (Curtains for OOL: Oxygen Was Present from the Start)

33. 3차원적 구조의 DNA 암호가 발견되다! : 다중 DNA 암호 체계는 진화론을 기각시킨다. (Three-Dimensional DNA Code Defies Evolution)

34. 41억 년 전에 생명체가 이미 지구에 존재했다고? : 새롭게 주장되는 최초 생명체의 출현 연대와 문제점들. (New First Life Estimate Creates More Problems)

35. 진화론을 논리적으로 허무는 생명정보이론 <부제: 컴퓨터 과학자가 본 다윈주의의 허구성>

36. 지성을 가진 잉크? (Intelligent Ink?)

37. 열수공에서 생명의 기원은 화학적으로 불가능해 보인다. (Hydrothermal OOL Chemistry Is Unlikely)

38. 가장 작은 세포는 진화론에 도전한다 : 473개 유전자들을 가진 세포가 자연 발생할 수 있을까? (Minimal Cell Challenges Naturalism)

39. 37억 년 전 화석의 발견으로 다시 써야하는 생명체 역사 : 세포의 자연발생에 필요한 시간은 더욱 줄어들었다. (Cellular Evolution Debunked by Evolutionists)

40. 4차원으로 작동되고 있는 사람 유전체 : 유전체의 슈퍼-초고도 복잡성은 자연주의적 설명을 거부한다. (The four dimensional human genome defies naturalistic explanations)

41. 생명정보의 비밀

42. 43억 년 전의 생명체가 발견됐다? : 가장 초기의 미생물도 오늘날의 것과 유사했다. ('Oldest Evidence' of Life?)

43. 엔코드 프로젝트에 뒤이은 4D 뉴클레옴 프로젝트는 DNA의 슈퍼-초고도 복잡성을 밝혀낼 것이다. (The 4D Nucleome Project Helps Creationist Research)

44. 생명의 기원에 관한 진화론자들의 속임수 (Origin-of-Life Theories Cheat)

45. 생명의 기원에 대한 자연발생설의 진화 : 최초의 생명체는 화산 온천에서 생겨났다? (Evolutionary Storytelling Evolves : the Case of Origin of Life. The Latest Episode in Evolving Origin-of-Life Stories.)

46. “화학적 진화”의 관점에서 본 유신진화론

47. 세포의 수선 메커니즘은 생명체의 자연발생설을 더욱 확실하게 기각시키고 있다. (Cell Repair Requirement Demolishes Origin-of-Life Speculation)

48. DNA에서 제2의 암호가 발견되었다! 더욱 복잡한 DNA의 이중 언어 구조는 진화론을 폐기시킨다. (Two Genetic Codes Is Better Than One)

49. 듀온 : DNA의 이중 암호는 진화론을 거부한다. (Duons: Parallel Gene Code Defies Evolution)

50. 유전자의 이중 암호는 고도의 지적설계를 가리킨다. (Dual-Gene Code Discovery Highlights Designed Biocomplexity)

51. 유전자의 이중 암호는 진화론을 완전히 거부한다. : 중복 코돈의 3번째 염기는 단백질의 접힘과 관련되어 있었다. (Dual-Gene Codes Defy Evolution...Again)

52. 섬모충의 유전체는 극도로 복잡했다. 2 : 유전체의 스크램블링과 암호화는 진화론을 거부한다. (Genome Scrambling and Encryption Befuddles Evolution)

53. 꿀벌의 고아유전자는 진화론을 쏘고 있었다. : 진화적 조상 없이 갑자기 등장하는 독특한 유전자들. (Honey Bee Orphan Genes Sting Evolution)

54. 후성유전체 연구는 세포에서 교향악단을 발견했다. (Epigenome Project Finds Symphony in Cells)

55. RNA 편집 : 새로운 차원의 초고도 생물복잡성 (RNA Editing: Biocomplexity Hits a New High)

56. ‘수평 유전자 전달’이라는 또 하나의 진화론적 신화 (Another Horizontal Gene Transfer Fairy Tale)

57. 사람 유전체는 4차원의 세계로 되어 있다. (Human Nucleome Reveals Amazing 4D World)

58. 2015년 노벨 화학상으로 부각된 세포의 DNA 손상 복구 메커니즘은 진화론을 거부한다. (2015 Nobel Prize Highlights Cell Repair Mystery)

59. 사람과 침팬지의 유전자 차이는 더욱 커졌다. : 각 생물에만 있는 고아유전자들은 진화론을 거부한다. (Genetic Gap Widens Between Humans and Chimps)

60. 후성유전학적 암호는 이전의 생각보다 훨씬 더 복잡했다. (Epigenetic Code More Complicated Than Previously Thought)

61. 유전체 내 바이러스성 정크의 기능이 발견되다. (Viral Genome Junk Hits the Trash)

62. 정크 DNA가 기능이 있음이 또 다시 확인되었다. : 모티프라 불리는 DNA의 직렬반복과 유전자 발현 (Junk DNA…Trashed Again)

63. 내부 텔로미어로 보이는 염기서열은 풍부하고 기능적이다. (Internal Telomere-like Sequences Are Abundant and Functional)

64. 유전자 코돈에서 중복/퇴화라는 개념의 몰락 (Codon Degeneracy Discredited Again)

65. 위-위유전자는 진화론 패러다임을 뒤흔들고 있다. (Pseudo-Pseudogenes Shake Up Evolutionary Paradigm)

66. 정크 DNA에서 발견된 경이로운 기능 : 정확한 위치로 분자 화물을 유도하는 항로 표지자 (Pinpoint Navigation and Propulsion in a Seemingly Random Soup)

67. 산호에서 발견된 RNA 편집은 진화론과 모순된다. : RNA 편집이라는 초고도 복잡성이 다양한 생물들에 있었다! (RNA Editing in Corals Stupefies Evolution)

68. 미래의 데이터 저장 장치로 DNA가 떠오르고 있다! (DNA Is the Future of Data Storage)

69. 일부 정크 DNA는 컴퓨터 메모리처럼 기능하는 것으로 보인다. (Some ‘Junk DNA’ May Act as Computer Memory)

70. 플라나리아의 유전체는 지적설계를 가리키고 있다. (Planaria Genome Loaded with Design Evidence)

Frank Sherwin
2018-12-19

플랑크톤은 그렇게 단순한 생물이 아니다. 

(Not-So-Simple Plankton)

Frank Sherwin


       플랑크톤(Plankton)은 해조류(algae), 박테리아, 원생동물과 같은 작은 해양생물들에 대한 일반적인 용어이다. 비록 작지만, 그들은 믿을 수 없도록 복잡한 초미세 구조로 이루어져 있다. 이러한 복잡성은 그리 놀라운 것이 아니다. 왜냐하면 이들 중 많은 개체들이 광합성(photosynthesis)을 통해 빛 에너지를 생명체에 필요한 에너지인 당분(sugars)으로 바꿀 수 있기 때문이다. 이 광합성 과정은 극도로 복잡하다. (복잡한 플랑크톤 이미지는 여기를 클릭)

박테리아와 단세포 해조류는 디메틸설포니프로피오네이트(dimethylsulphoniopropionate, DMSOP)이라 불리는 황 화합물을 생산하는 것이 발견되었다.[1] 이 발견은 전 지구적 황 순환(sulfur cycle)에서, 아마도 매년 수십억 톤의 새로운 황이 만들어지는 것으로 이는 막대한 양의 황의 기원에 대한 설명을 이끌어냈다. 이것은 중요하다. 왜냐하면 연구자들은 ”그 순환에서 완전히 예상치 못한 지름길을 발견했기 때문이다.” 예나대학(University of Jena)의 한 화학자는 ”우리의 현재 통찰력은 플랑크톤에서 숨어있던 극도로 복잡하고 효율적인 시스템을 다시 한번 밝혀냈다”고 말했다.[2]

플랑크톤은 세포 표면에 센서(sensors)가 설치되어 있어서, 염분 농도가 다르고, 산소 스트레스가 있는 해양 생태계들을 이동하고 채울 수 있도록 설계되어있다. 창조과학자들은 최근 발견된 지름길 경로를 비롯하여, 이러한 대사 경로들이 태초 이후로 있었다고 믿고 있다. 덧붙여서 플랑크톤 내부의 생화학적 특성은 환경적 노출에 의해 생겨난 것이 아니라, 환경적 스트레스에 견딜 수 있도록 처음부터 장착되어 있었던 것이라는 것이다. 

단순한 생명체 같은 것은 없다. 살아있다면 그것은 복잡한 것이다.

단순한 생명체 같은 것은 없다. 살아있다면 그것은 복잡한 것이다. 진화론자들은 생명체가 어떻게든 비-생명체로부터 우연히 저절로 생겨났다고 주장하지만, 그들은 지구상에 생명체가 언제 어디에서 나타났는지 알지 못한다. 두 명의 연구자는 ”일찍이 발견된 가장 오래된 화석은 35억 년 전의 것이라고 말한다.” 반면에 다른 두 명의 연구자는 ”지구상에서 산소의 광합성은 약 25억 년 전에 출현했다고 말한다...”[4] 이들 박테리아 같은 생명체는 광합성을 하고 있었다는 것에 모두 동의한다.

위에서 언급했듯이, 극도로 정교한 초고도 복잡성의 과정이 간단한 생명체로 주장되고 있는 것들에서 발견되고 있다. 그러한 발견은 설계자가 계심을 가리키는 것이다.



References  
1. Thume, K. et al. 2018. The metabolite dimethylsulfoxonium propionate extends the marine organosulfur cycle. Nature. 563. 412-415.
2. Garrison, T. and R. Ellis. 2016. Oceanography, 9th edition, Independence, KY: Cengage Publishing, 16.
3. Nelson, D. and M. Cox. 2017. Principles of Biochemistry. NY: W. H. Freeman, 776.

*Mr. Sherwin is Research Associate is at ICR. He has a master’s in zoology from the University of Northern Colorado. Article posted on December 13, 2018.



번역 - 미디어위원회

링크 -https://www.icr.org/article/11106/

출처 - ICR, 2018. 12. 13.

구분 - 4

옛 주소 -  http://www.kacr.or.kr/library/itemview.asp?no=6960


참고 : 

1. 동물성 플랑크톤에서 발견된 다연발의 작살! : 하등하다는 원생동물에서 고도로 복잡한 기관의 발견 (Lowly Plankton Packs High-Caliber Heat)

2. 전 세계에 유익을 주고 있는 작은 바다생물들 : 동물성 플랑크톤은 바닷물의 혼합에 중요한 역할을 한다. (Tiny Life Benefits the Whole World)

3. 진화론을 거부하는 규조류 : 정교한 구조와 다양한 아름다움을 가진 경이로운 생물. (Homage to Diatoms)

4. 규조류 진화의 미스터리 (Diatom Evolution a Mystery)

5. 식물의 광합성은 양자물리학을 이용하고 있었다. (Photosynthesis Uses Quantum Physics)

6. 진화론자들이 자주 사용하는 말, “생각했던 것보다 일찍” : 광합성, 육상식물 등의 출현 시기는 더 내려갔다. (Most Common Phrase in Evolution Media: “Earlier Than Thought”)

7. 식물에 내장되어 있는 광합성 조절 스위치 (Plants' Built-in Photosynthesis Accelerators)

8. 녹색 파워 광합성 : 경이로운 식물의 태양광 발전소 (Green power (photosynthesis) God’s solar power plants amaze chemists)

9. 광합성의 양자 비밀이 밝혀졌다. (Quantum Secret of Photosynthesis Revealed)

10. 식물들은 빛과 광합성을 최고 효율로 얻고 있다. (Respect Your Plant: Don’t Say it Evolved)

11. 광합성은 생각보다 10억 년은 앞서서 37억 년 전에 이미 시작되었다? (Photosynthesis began a billion years earlier than thought)

12. 광합성의 진화에 대한 밝은 빛[2] (Shining light on the evolution of photosynthesis)

13. 광합성의 진화에 대한 밝은 빛[1] (Shining light on the evolution of photosynthesis)

14. 43억 년 전의 생명체가 발견됐다? : 가장 초기의 미생물도 오늘날의 것과 유사했다. ('Oldest Evidence' of Life?)

15. 41억 년 전에 생명체가 이미 지구에 존재했다고? : 새롭게 주장되는 최초 생명체의 출현 연대와 문제점들. (New First Life Estimate Creates More Problems)

16. 37억 년 전 화석의 발견으로 다시 써야하는 생명체 역사 : 세포의 자연발생에 필요한 시간은 더욱 줄어들었다. (Cellular Evolution Debunked by Evolutionists)

17. 브롬이 없다면, 생물들은 존재할 수 없었다. : 생명체가 존재하기 위한 필수적 원소는 28개 (Without Bromine, There Would Be No Animals)

18. 화학진화는 사실인가? : 생명체의 자연발생설은 부정된 이론이다. (Is chemical evolution true?)

19. 가장 간단한 미생물도 생각보다 훨씬 더 복잡했다. : 마이코플라즈마는 200 개의 분자기계들과 689 개의 단백질들을 만드는 유전자들을 가지고 있었다. (Simplest Microbes More Complex than Thought)

20. 계속되는 어리석은 진화 이야기들. 생명의 기원 : 무지의 분야 (Irresponsible Reporters Push Evolution With Silly Notions. Origin of Life: A Field of Ignorance)

21. 자연발생설 : 물과 산소 문제 (Abiogenesis: Water and Oxygen Problems)

22. 생명의 기원에 관한 진화론자들의 속임수 (Origin-of-Life Theories Cheat)

23. '생명의 기원' 논란의 종지부 : 산소는 처음부터 있었다. (Curtains for OOL: Oxygen Was Present from the Start)

24. 현대적 모습의 2억3천만 년 전(?) 진드기. : 심지어 호박 속 아메바도 동일한 모습이었다. (Why Do Creatures in Ancient Amber Look So Modern?)

25. 동전의 앞면은 진화론의 승리, 뒷면은 창조론의 패배? : 20억 년 이상 동일한 황세균의 발견. (Heads, Evolution Wins—Tails, Creation Loses?)

26. 20억 년(?) 동안 진화하지 않은 황세균. : 가장 오래된 '살아있는 화석'의 발견에도 진화론은 유지된다. (Two Billion Years and No Evolution)

27. 지구에는 막대한 수의 박테리아들이 존재한다. (Bacteria Rule the Earth)

28. 하등하다고 주장되는 생물들이 어떻게 첨단 물리학을 알고 있는가? (How Did Primitive Organisms Learn Physics?)

29. 미생물도 의사소통을 하고 있었다! (Microbes Talk More than People Do)

30. 생명체의 본질로서 정보 통신 (Life as the Communication of Information)

31. 토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. (Iron-mining Fungus Displays Surprising Design)

32. 박테리아의 놀라운 빛 감지 능력 : 렌즈와 같은 세포 (The Crawling Eye: Cells as Lenses)

33. 바이러스는 바다를 좋게 만들 수 있다. (Viruses May Do the Ocean Good)

34. 세포의 미토콘드리아 세망은 도시 전력망을 닮았다. (Cell Feature Resembles Power Grid)

David F. Coppedge
2018-07-13

생체모방공학과 경이로운 세포에 관한 새로운 소식들 

(More Reasons to Imitate Biology. Cellular Wonders Coming Into Focus)


 최근 생체모방공학(Biomimetics)에 관한 기사들에 따르면, 이 분야의 미래는 여전히 밝다.

▶ 의약품을 개선하기 위해 새로 개발된 분자는 자연에서 불소(fluorine)를 처리하는 특수 효소로부터 영감을 얻었다.(Colorado State, Phys.org. 2018. 5. 11). 불소와 반응하는 효소를 모방하여 더 강력하고 안정적인 약제를 만들어낼 수 있다는 것이다.

▶ 모유에 들어있는 당(sugars)은 아기의 장내미생물 군을 형성하고 감염을 예방하고 있다는 것이다. (Medical Xpress, 2018. 5. 10). 모유에 대한 연구는 유제품의 질을 향상시킬 수 있다.

▶ 제한된 주파수 대역폭(bandwidth)을 보다 효율적으로 사용하는 방법은? 동굴에 사는 물고기처럼 생각하라. (Science Daily, 2018. 5. 9). 자연에서 영감을 받은 전파방해(jamming) 회피 장치로 무선통신 대역폭을 더 현명하고 저렴하게 사용할 수 있다.

▶ 속도 향상을 위한 설계 : DNA 나노기계는 (속도에 있어서) 한 차원 앞선 진보된 방법을 보여주고 있다. (Phys.org, 2018. 5. 7). ”단백질 모터와 같은 살아있는 생물 내의 시스템은 경이로운 속도를 보여주고 있다. 훨씬 빠른 시간 내에 가닥변위(strand displacement)와 같은 유사한 해리를 수행할 수 있다.”

▶ 레이저로부터 동력을 얻는 무선 '로봇파리'는 곤충처럼 보인다. (Live Science, 2018. 5. 17). 그러나 곤충은 레이저 없이도 그렇게 할 수 있다.

▶ 연구자들은 공기 조절 직물(air-conditioned fabric)을 만들기 위해서, 혜성나방(comet moth)의 실크 섬유를 모방했다. (Phys.org, 2018. 5. 18)

▶ 개미의 경로 찾기 능력은 맵핑 소프트웨어를 부끄럽게 만들고 있었다. (Nature, 2018. 5. 18). 울퉁불퉁한 지형에 직면한 개미는 목적지까지 자주 가장 짧은 경로 보다는 가장 빠른 경로를 택하고 있었다.

▶ 인공지능(artificial intelligence, AI)이 연금술이 되었는가? (Science Magazine, 2018. 5. 4). 인공지능은 특별한 작업을 수행할 수 있다. 하지만 실제 인간의 마음처럼 작동하지는 않는다. 마음을 모방하려는 탐구는 연금술과 같은 의사과학이다, 매튜 허트슨(Matthew Hutson)은 쓰고 있었다.

▶ 우리가 의식(consciousness) 이론을 알 필요가 있는 이유. 마음에 관한한 다양한 세속적 이론들이 생겨났고, 사라졌다. (The Conversation, 2018. 5. 11)


최근 세포(cells)에 관한 연구들은 세포의 복잡성과 경이로움을 계속 밝혀내고 있다. 더 높은 배율에서 살펴본, 세포 속에 있는 나노 기계들은 훨씬 더 장엄했다 :

▶ 세포의 에너지 센터에 관심이 집중되고 있다. (Science Magazine, 2018. 5. 11).

▶ F1-ATPase 분자 모터의 탄성 커플링 동력 메커니즘. (PNAS).

▶ 엽록체의 ATP 합성 효소(ATP synthase)의 구조, 메커니즘, 및 조절 (Science Magazine, 2018. 5. 11).

▶ 지질막 내의 효모 ATP 합성 효소에 대한 고해상도 저온 전자현미경(cryo-EM) 분석 (Science Magazine, 2018. 5. 11).

▶ 능률적인 코딩은 인간 지각의 일반화의 보편적 법칙을 설명한다. (Science Magazine, 2018. 5. 11).

▶ 세균성 나트륨 채널의 이온 시발성 선택. (PNAS)

▶ 외인성 생화학적 요인의 결여로 인해 핵 재프로그램으로 유도되는 세포의 측면으로 한정된 성장. (PNAS, 2018. 5. 7)

▶ 기공(우리에게 호흡을 선사하는 식물의 구멍)은 MUTE라 불리는 유전자 덕분에 발생한다. (Phys.org, 2018. 5. 7)

▶ 내강(lumen) 성장의 물리학 (PNAS). ”세포 간 구멍(내강)의 발달은 생물이 복잡한 조직 구조를 형성하도록 해주는 편재하는 메커니즘이다.”

▶ 뼈의 프랙탈과 같은 위계 조직은 나노 스케일로 시작된다. (Science Magazine, 2018. 5. 4). ”뼈의 구성 요소는 내구성과 견고성을 제공하기 위해 계층적으로 조립되어 있었다.”



과학자들도 모방하고 싶어 하는, 이러한 생물의 고도로 효율적인 기능과 복잡성을 가진 구조들이 목적도 없고, 방향도 없고, 지성도 없는, 무작위적인 복제 오류로 우연히 생겨날 수 있었을까? 세포 내의 초고도로 복잡한 분자기계들과 그것들은 만드는 유전정보들이 모두 우연히 무작위적인 과정으로는 생겨날 수 없어 보인다. 조금만 생각해 보라.  



번역 - 미디어위원회

링크 - https://crev.info/2018/05/reasons-imitate-biology/ 

          https://crev.info/2018/05/cellular-wonders-coming-focus/

출처 - CEH, 2018. 5. 25.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6867


참고 : 

1. 하나님의 놀라운 접착제 : 물속에서 달라붙는 한 편형동물의 경이로운 능력 (God's amazing glue)

2. 조개껍질과 나비를 모방한 나노제품 (Nanofabrication Imitates Shells, Butterflies)

3. 폭격수 딱정벌레를 모방한 새로운 분무기 (New Atomizer Mimics Bombardier Beetle)

4. 한 발 다가선 도마뱀붙이 모방 접착제  (A Step Closer to Gecko Adhesive)

5. 규조류를 이용한 고효율 태양전지 (Better Solar Cells with Diatoms)

6. 가시 랍스터(닭새우)의 자기이상 인식 기술을 모방하여 이동하는 로봇 (Robot Navigation Copies Spiny Lobsters)

7. 돌고래의 매끄러운 피부를 모방한 새로운 선체 기술 (New Hull Technology a Slick Design Copy)

8. 곤충을 따르라! : 생체모방공학의 새로운 연구들 (Follow the Insects)

9. 도마뱀붙이의 발바닥 오염을 제거하는 슈퍼소수성 인지질. (Scientists Discover New Clue to Geckos' Climbing Ability)

10. 새우 껍질은 새로운 생분해성 재료에 영감을 주고 있다. :생체모방공학의 또 하나의 사례 (Shrimp Shells Inspire New Biodegradable Material)

11. 생체모방공학을 통한 강렬한 희망 1 : 계속 발견되고 있는 생물들의 경이로운 능력들 (Living Surprises, Living Hopes)

12. 생체모방공학을 통한 강렬한 희망 2 : 계속 발견되고 있는 생물들의 경이로운 능력들 (Living Surprises, Living Hopes)

13. 차세대 리더는 식물과 동물이다! (Follow the Leader: Plants and Animals)

14. 단풍나무 씨앗을 모방한 소형 비행 로봇 (Maple to the Rescue)

15. 식충식물이 R&D 수상을 이끌다 : 생체모방공학의 새로운 기술들 (Pitcher Plant Inspires R&D Award)

16. 생물에서 발견되는 경이로운 기술들 : 나비 날개의 광흡수, 소금쟁이의 부양성, 생물학적 배터리 (From Wonders of Nature to Wonders of Technology)

17. 자연이 38억 년 동안 연구개발을 했는가? : 생체모방공학의 계속되는 성공 - 해바라기, 규조류, 식물 의약품... (Nature : 3.8 Billion Years of R&D)

18. 개, 올빼미, 딱정벌레를 모방하라 : 생체모방공학은 우리의 삶을 증진시킬 것이다. (Make Like a Dog, Owl, or Beetle : How Biomimetics Will Improve Our Lives)

19. 생체모방공학 소식으로 시작되는 한 해 (Happy New Biomimetics Year)

20. 계속되는 생체모방공학의 성공 : 반딧불이, 나무, 피부, DNA, 달팽이처럼 만들라. (Make Like a Firefly)

21. 큰부리새, 굴, 거미를 이용한 생체모방공학 (What Do a Toucan, an Oyster and a Spider Have in Common? Bio-Engineers’ Drool)

22. 생체모방공학의 여러 소식들 (Biomimetics Roundup)

23. 먹장어, 도마뱀붙이, 잠자리의 생체모방공학 (Of Hagfish, Geckos and Dragonflies)

24. 개구리 발바닥을 모방하라! : 더러운 곳과 물속에서도 사용할 수 있는 접착 테이프 (A Sticky Solution : God Invented It First)

25. 광합성의 양자 비밀이 밝혀졌다. (Quantum Secret of Photosynthesis Revealed)

26. 식물이 전기 신호를 보내고 있다는 충격적 증거! (Shocking Evidence of Electrical Signals in Plants)

27. 식물을 사랑해야 될 더 많은 이유들 (More Reasons to Love Plants)

28. 동물과 식물의 경이로운 기술들 : 거미, 물고기, 바다오리, 박쥐, 날쥐, 다년생 식물 (Animal and Plant Tricks)

29. 편평한 식물 잎에 숨어있는 놀라운 설계 (Flat leaves—a curly problem)

30. 해파리 : 바다에서 가장 효율적인 수영선수! (The Ocean’s Most Efficient Swimmer Is… A Jellyfish)

31. 나비의 날개 : 방수 옷에 영감을 불어넣다. (Butterfly Wings: Inspiration for Waterproof Clothing?)

32. 놀라운 능력의 동물들 : 코끼리, 돌고래, 물고기, 꿀벌, 거미, 무당벌레 (Amazing Animals)

33. 여우는 자기장을 감지할 수 있는가? (Do Foxes Have Magnetic Senses?)

34. 생물권 전역에서 공학적 설계가 발견되고 있다. : 생체모방공학의 계속되는 행진 (Engineering Designs Found Throughout the Biosphere)

35. 역공학이 밝혀낸 이상적 추진 방식. : 생물들의 유사한 공학적 구조는 우연(수렴진화)인가, 설계인가? (Reverse Engineering Reveals Ideal Propulsion Design)

36. 모든 발명에 영감을 주고 있는 생체모방공학 (Biomimetics Is All About Design Inspiration)

37. 고양이의 수염과 일각고래의 엄니는 감각기관. 그리고 바다뱀, 초파리, 캐나다두루미의 놀라운 특성들. (Cat Whiskers and Narwhal Tusks: Why Things Are)

38. 물 위에서 걸을 수 있도록 하는 설계 : 소금쟁이 다리에서 발견된 최적화된 기하학 (Designed to Walk on Water)

39. 경이로운 공학 기술이 수백만 년의 자연적 과정으로? : 생체 모방 공학자들의 논리적 오류 (Millions of Years of Evolution Equal Engineering?)

40. 딱따구리, 혈액응고, 분자모터를 모방한 생체모방공학 (Three More Ways to Benefit from Nature’s Designs)

41. 식물도 눈을 가지고 있다. (Even the Plants Have Eyes)

42. 과학자들도 놀라는 기능들이 우연히 생겨날 수 있을까? : 거미, 빗해파리, 개미, 새, 삼나무, 개구리, 문어, 상어.. (Wonderful Lives)

43. 진화론을 거부하는 규조류 : 정교한 구조와 다양한 아름다움을 가진 경이로운 생물. (Homage to Diatoms)

44. 동물들의 새로 발견된 놀라운 특성들. : 개구리, 거미, 가마우지, 게, 호랑나비, 박쥐의 경이로움 (New Amazing Animal Discoveries)

45. 생물들의 정교한 공학기술과 최적화. : 박쥐, 말벌, 물고기, 꿀벌, 개미, 얼룩말과 생체모방공학 (Life Shows Exquisite Engineering and Optimization)

46. 문어의 피부를 모방한 최첨단 위장용 소재의 개발. (Octopus Skin Inspires High-Tech Camouflage Fabric)

47. 위장의 천재 문어는 피부로 빛을 감지하고 있었다! : 로봇 공학자들은 문어의 팔은 모방하고 있다. (The Octopus: Invertebrate Designs)

48. 생체모방공학의 새로운 뉴스들. (What’s New in Biomimetics?)

49. 생물들의 놀라운 기술과 생체모방공학 : 이러한 기술들이 모두 우연히 생겨났을까? (Inspiring Life Tricks)

50. 생체모방공학 분야는 지속적으로 확장되고 있다 : 뼈, 힘줄, 곰팡이, 법랑질, 효모, 곤충, 홍합, 말벌, 파리매... (Weekend Biomimetics Showcase)

51. 뼈의 미세구조를 모방하여 개량된 균열에 강한 강철 (Improved Steel Copies Bone Microstructure)

52. 박쥐의 비행을 모방한 최첨단 비행 로봇의 개발 (Bats Inspire High-Tech New Flying Robots)

53. 탁월한 방법으로 물을 모으고 있는 사막식물 대황 : 이 식물을 모방하여 건조지역의 지면피복재를 개발한다. (Desert Rhubarb—Three-Foot Oasis)

54. 세상에서 가장 작은 나침반 : 보잘 것 없는 박테리아도 방향을 감지할 수 있었다. (The world’s smallest compasses)

55. 아무것도 아닌 것들 : 미세세계에서 보여지는 놀라운 창조의 증거들 (The things that are not)

56. 포자 내부에는 나노 기술이 들어있다. (What's Inside a Spore? Nanotechnology)

57. 이 세균은 탱크처럼 이동한다. (This Bacterium Moves Like a Tank)

58. 세포들은 그들의 신체 위치를 결정하는 데에 우편번호를 사용한다. (Cells Use Zip Codes to Determine Their Body Location)

59. 세균의 편모 : 고도로 복잡한 초미세 구조가 우연히? (Evolution of the Flagellum : And the Climbing of ‘Mt. Improbable’)

60. 작동 중인 분자기계 리보솜을 보라. (Watch a Ribosome in Action)

61. 박테리아 편모의 모터는 단백질 클러치를 가지고 있었다. (Bacterial Flagellar Motor Has a Protein Clutch)

62. 균류에 있는 가장 빠른 분사기 (Fastest Squirt Gun in the Fungi)

63. 스트레소좀 : 박테리아의 정교한 대처 메커니즘 (Stressosomes: Bacteria's Ingenious Coping Mechanism)

64. 바이러스도 분자 모터들을 가지고 있었다. (Virus Motors Impossible for Evolution)

65. 자기희생 세포들은 자신을 내어주신 설계자를 증거한다. (Self-sacrificing Cells Demonstrate a Selfless Designer)

66. 세포의 분자 모터들은 함께 협력해서 작동한다. (Cell Motors Play Together)

67. 단순한 생물체 같은 것은 없다. (There’s No Such Thing as a ‘Simple’ Organism)

68. 점균류의 네트워크는 철도 시스템을 능가하고 있었다. (Slime Networks Are Better Organized than Railway Systems)

69. 단순한(?) 아메바가 박테리아를 사육하고 있었다. ('Simple' Amoebas Can Farm Bacteria)

70. 박테리아가 노화에 저항하는 독창적인 방법 (The Ingenious Way That Bacteria Resist Aging)

71. 효소는 진화할 수 없었음을 새로운 연구는 보여주었다. (New Study Shows Enzymes Couldn't Evolve)

72. 나노기술과 창조주

73. 분별없이 박테리아를 미워하지 말라! (Don’t Hate Bacteria Irrationally)

74. 새로운 분자 모터 클러치가 발견되었다. (Scientists Discover New Molecular Motor 'Clutch')

75. 바이러스는 바다를 좋게 만들 수 있다. (Viruses May Do the Ocean Good)

76. 세균의 대사는 컴퓨터 회로판과 같이 작동된다. (Bacteria Metabolisms Are Like Computer Circuit Boards)

77. 세포의 미토콘드리아 세망은 도시 전력망을 닮았다. (Cell Feature Resembles Power Grid)

78. 세포가 저절로 만들어졌다고?

79. 박테리아의 놀라운 빛 감지 능력 : 렌즈와 같은 세포 (The Crawling Eye: Cells as Lenses)

80. 토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. (Iron-mining Fungus Displays Surprising Design)

81. 생명체의 본질로서 정보 통신 (Life as the Communication of Information)

82. 동물성 플랑크톤에서 발견된 다연발의 작살! : 하등하다는 원생동물에서 고도로 복잡한 기관의 발견 (Lowly Plankton Packs High-Caliber Heat)

83. 미생물도 의사소통을 하고 있었다! (Microbes Talk More than People Do)

David F. Coppedge
2018-05-28

페일리의 시계가 생물체 내에서 발견되었다. (Paley’s Watch Found)


       생물체 내에 실제로 시계(watch)가 있었다. 그것은 우리 몸 안에도 있다.

시계란 무엇인가? 시계에 대한 하나의 예가 있다. 윌리엄 페일리(William Paley)는 1805년에 다윈에게 영향을 줬던 책인 ‘자연신학(Natural Theology)’에서, 그의 유명한 '시계공 논증(watchmaker argument)'을 발표했다. 페일리는 벌판에서 시계 하나를 우연히 발견했을 때, 유추해볼 수 있는 것을 묻고 있었다. 시계는 어떻게 있게 되었는가? 제작자가 있어서 제작한 것일까, 우연히 저절로 생겨난 것일까? 페일리는 설득력 있는 분석을 통해, 마이클 베히(Michael Behe, ‘다윈의 블랙박스’의 저자)의 ‘한 요소도 제거 불가능한 복잡성(irreducible complexity, 환원 불가능한 복잡성)’과 더글라스 엑스(Douglas Axe)의 ‘기능적 전체(functional wholes)’라는 논쟁에 영향을 주었다. 페일리의 '시계공 논증'은 지적설계를 위한 논리적 주장의 기초를 놓았던 것이다.

모든 시계들이 시계는 아니기 때문에, 시계의 다른 예들이 페일리의 주장을 지지하는지를 확인해야한다. 매일 자전하는 지구를 일종의 시계라고 말하며 페일리의 주장을 논박할 수도 있겠지만, 이것은 ‘한 요소도 제거 불가능한 복잡성(irreducibly complex)’이 아니다. 논쟁의 요점은 설계된 시계는 정확하게 시간을 가리키는, 하나의 목적을 갖기 위하여 조직되어 있다는 것이다. 자전하는 지구는 시간을 가리키고 있지 않다. 시계는 시간이 얼마나 흘렀는지를 알기 위한 목적으로 사람에 의해서 만들어진 것이다. 그리스 사람은 물시계를 갖고 있었다. 초기 중세시대의 사람들은 모래시계를 가지고 있었다. 크리스티안 하위헌스(Christian Huygens)는 진자시계를 발명했다. 과학이 발전함에 따라, 스프링과 기어를 사용하는 시계가 만들어졌고, 전자시계, 원자시계는 놀라운 정확도를 갖도록 발전되었다. 이제 시간을 측정하는 장치들은 매우 정확하여, 과학자들은 천문학적 현상과 동시화시키기 위해 수년마다 약간의 시간을 조정하고 있으며, GPS 위성에서 일어나는 극히 작은 차이도 보정하고 있다.

페일리의 비평가들은 모래시계와 같은 초기의 시간 계측 장치는 ‘한 요소도 제거 불가능한 복잡성(irreducibly complex, IC)’이 아니라고 말할 수도 있다. 왜냐하면 자연에서 유사한 반복적인 과정은 사람에게 시간 정보를 제공할 목적으로 발생하지 않았다고 하더라도, 시간을 추론하는데 사용될 수 있기 때문이다. 예를 들어 밀물과 썰물, 나일강의 상승 및 하강, 또는 정기적인 간헐천의 분출 등이 그러할 수 있다고 주장한다. 그러나 사람의 시계는 확실히 ‘한 요소도 제거 불가능한 복잡성’이 될 수 있다. 자연주의적 과정으로 현대의 원자시계가 우연히 만들어졌을 것이라고는 아무도 생각하지 않는다.

‘한 요소도 제거 불가능한 복잡성’ 시계의 한 가지 특징은 기능을 수행하기 위한 스위치들이 들어있다는 것이다. 시계에서 자주 볼 수 있는 것은 어떤 작동을 켜고 끄는 기계적 장치들이다. 알람을 설정하는 것도 하나의 예일 수 있다. 오늘날 스마트폰 시계는 모든 종류의 응용프로그램들을 전환할 수 있는 스위치를 갖고 있으며, 시간이 지나면 원하는 기능을 인터넷으로 연결하여, 멀리 떨어진 곳에서 가전기기를 작동시킬 수도 있다. 모래시계는 이러한 추가적 기능들이 부족하다. 독립적인 다른 기능으로 전환될 수 있는 시계를 볼 때마다, ‘한 요소도 제거 불가능한 복잡성’에 가까워지고 있다. 수많은 기능들을 켜거나 끄고, 동시에 외부 입력에 응답하여 반응하고, 엄격한 제약 조건 내에서 이러한 기능이 조절되고 있다면, 이것은 ‘한 요소도 제거 불가능한 복잡성’에 대한 매우 설득력 있는 사례가 된다. 1805년 시대에 페일리의 시계가 ‘한 요소도 제거 불가능한 복잡성’이었다면, 시간이 흐름에 따라 적응하고, 스위치를 켜거나 끄고, 전체를 조절하는 시스템은 얼마나 더 복잡한 것일까?


생체시계

이제 우리는 그러한 시계가 존재한다고 말하려고 한다. 모든 살아있는 생물체 내에는 일주기시계(circadian clock, 생체시계)가 있다. Science 지는 최근 생체시계에 관한 논문 모음집을 발표했다. Perspective의 기사에서 밀리우스(Millius)와 우에다(Ueda)는 생물체가 일주기 메커니즘을 필요로 하는 이유와, 생체시계에 관해 늘어나고 있는 새로운 지식에 대해 논의하고 있었다 :

규칙적인 유전자 발현, 세포 활동, 또는 생리적 행동의 변화에 의해서 측정될 수 있는, 내부 생물학적 리듬인 일주기시계(생체시계)는 생물체가 환경에서 매일의 주기적 변화를 예상할 수 있도록 해준다.

Credit: Illustra Media

인용문에 의하면, 시계 메커니즘은 일련의 정보인 유전자(genes)들에서 비롯되는 것으로, 자연의 법칙(밀물 썰물과 같은)을 따라 일어나는 단순한 주기 같은 것이 아니라는 것이다. 또한 이러한 유전자들은 세포활동이나 생물체에 중요한 행동과 활동에 대한 스위치를 켜고 끌 수 있다는 것이다. 유전자들은 햇빛과 같은 외부적 환경의 변화에 맞추어 조정될 수 있다. 생체시계가 스위치를 켜서 작동되는 기능들은 다수가 있다, 그 기사는 그것을 말하고 있었다. 그 결과는 개별 단백질이나 기관의 형성에서부터, 생물 몸 전체에 이르기까지, 모든 스케일에서 발생한다. 더욱 흥미로운 사실은 조직(tissues) 사이에서 시간을 계측하는 기능들이 서로 다르다는 것이다. 이는 일주기성 생체리듬의 조절이 각 조직, 각 장기, 전체 생물(예로 야행성 동물)에 맞추어져 있음을 가리킨다. 다음은 한 영장류인 올리브개코원숭이(olive baboon)의 조직에서 유전자 발현을 측정했을 때, 연구자들이 발견한 복잡성의 예이다 :

연구자들이 유비쿼터스 발현 유전자라고 부르는, 약 11,000개의 전사인자(transcripts)들이 64개의 모든 표본 조직에서 발현되고 있었다. 여기에는 DNA 수리, 전사, 단백질 항상성과 같은 기본적 세포기능에 관여하는 많은 유전자들이 포함된다. 이들 어디에나 존재하는 발현 유전자들의 대부분은 적어도 하나의 조직에서 주기적인(rhythmic) 것이지만, 조직 간의 주기적 유전자들은 거의 중복되지 않고 있었는데, 이것은 조직 특이적 메커니즘이 진동 발현(oscillatory expression)을 조절하고 있음을 가리키는 것이다. 예를 들어, 간에서 주기적으로 발현되는 한 유전자는 심장에서 구성 요소로써 발현되고 있었다. 유비쿼터스로 발현되는 유전자들은 기본적인 생물학적 과정들을 제어하고 있기 때문에, 그들의 발현 시기는 조직의 전반적인 기능에 영향을 줄 수 있다. 예를 들어, 갑상선 또는 부신에서 토세포현상(exocytosis)의 일주기 조절은 내분비 인자(endocrine factors)들의 주기적 분비를 가능하게 할 수도 있는데, 이것은 토세포현상의 시기가 기능면에서 덜 중요한 다른 장기와 비교된다.

 

전체 유전체 시계

Credit: Illustra Media

Science(2018. 3. 16) 지에 게재된 또 다른 논문에 의하면, 전체 유전체(whole genome)는 그 자체가 일주기 항상성을 유지하도록 조직화되어 있다는 것이다. 즉 외부적 섭동에도 불구하고, 정확한 시간 계시가 가능하다는 것이다.

유전체의 먼 부위 사이의 물리적 접촉 가능성에 대한 지도(maps)는 유전체가 고도 국소적인 인트라도메인 염색질섬유(intradomain chromatin-fiber)의 접촉 빈도를 보여주는, 위상학적 관련 도메인(topologically associating domains, TADs)으로 조직되어 있음이 밝혀졌다. TAD가 억제됨으로써, 증강 프로모터(enhancer-promoter, E-P) 접촉의 특이성이 증가된다는 것을 고려하여, TAD 형성의 메커니즘과 동력학이 심도 있게 연구되고 있는 중이다.

유전자 발현을 조절하는 이 조직은 항상성에서 예상되는 것처럼 매우 특이적이다. 그러나 그것은 또한 유연성을 보여준다. Science 지의 논문은 생체시계가 안정적 일뿐만 아니라, 변화하는 조건에도 적응할 수 있다는 것을 보여주고 있었다 :

외부 신호에 반응하여 표현형을 변화시킬 수 있는 힘인, 표현형의 유연성(plasticity)은 환경 변화에 적응할 수 있게 해주고, 탄력적인 유전자 조절을 필요로 한다. 적응적 유연성의 한 정교한 예는 생리학, 대사활동, 행동에서 24시간 주기를 확립해주는 일주기 생체시계이다. 빛과 음식 섭취와 같은 외부의 시간 신호가 변동될 때, 재설정될 수 있기 때문에, 일주기성 항상성은 빛에 민감한 생물체가 매일의 환경 주기를 예측하고 적응할 수 있게 해준다. 1274 페이지의 이 이슈에 대한 글에서, 김(Kim et al.) 등은 쥐에서 생리적 일주기 동안 전사 유연성에 대한 유전체 전체의 복잡성을 엿볼 수 있게 해주며, 이것은 우리에게 생체시계의 조절 실패와 관련된 질병들을 이해할 수 있게 해준다.


세포주기 시계

또 다른 유형의 시계는 과정들이 적절한 순서로 일어나도록 보장하고 있기 때문에, 낮 시간을 알 필요가 없었다. 사업 프로젝트 관리자들은 다른 단계를 시작하기 전에 완료해야 할 단계와 같은, 프로젝트 단계들의 순서들이 배치되어 있는, 간트 차트(Gantt charts) 또는 퍼트 차트(Pert charts)와 친숙하다. 프로젝트 책임자는 단계마다 이루어져야하는 사건에 기초하여, 다음 단계를 진행할지 안할지를(go or no-go) 결정하기 위한 체크 포인트를 설정할 수 있다. 그것이 세포가 하고 있는 것이었다. 세포는 자신을 복제할 때 정확히 그러한 일을 하고 있었다. Phys.org(2018. 3. 26) 지는 단백질들이 세포주기를 어떻게 조절하는 지를 보여주고 있었다.

Credit: Illustra Media

세포 분열(cell division)은 모든 생명체의 기초이다. 이 복잡한 과정에서 가장 작은 오류조차도 암과 같은 중대한 질병을 일으킬 수 있다. 특정 단백질은 적절한 세포분열을 위해서, 특정 시간에 켜지거나 꺼져야 한다. 마틴 루터 대학의 생물물리학자이자 의학생화학자인 할레 비텐베르크(Halle-Wittenberg)는 이 과정의 기본 메커니즘을 설명했다. 그들은 세포의 서로 다른 신호전달 경로가 어떻게 단백질들의 구조를 변화시켜 정확한 시기에 정확한 방향으로 세포 분열주기를 유도하는지를 보고했다. 연구자들은 그들의 발견을 National Academy of Sciences의 Proceedings 지에 발표했다.

세포 주기는 ‘한 요소도 제거 불가능한 복잡성(irreducibly complex, 환원 불가능한 복잡성)’이라는 것을 누구도 의심하지 않는다 :

세포주기는 극도로 복잡하고 정확하게 진행되는 과정이다. ”모세포는 기존 유전자들을 두 배로 갖고 있는데, 딸세포로 나눠진다. 이렇게 하기 위해서는, 매우 특정한 시기에 수많은 유전자들의 스위치를 켜고 꺼야한다”라고 MLU의 생물물리학자인 요첸(Jochen Balbach) 교수는 말한다. 세포주기는 여러 단계들로 세분화 된다. 이들은 CDK 억제제(CDK inhibitors)라 불리는 억제 단백질로 알려진 것들에 의해서 조절된다. 적색 신호등처럼, 이들 단백질들은 세포가 관련 시작 신호를 줄 때까지, 다음 단계로의 전환을 차단한다.


결론

페일리의 시계가 발견되었다. 그것은 벌판에서 발견한 시계처럼, 항상 생물체의 몸 안에 있었다. 흥미로운 점은 그 시계는 페일리가 상상했던 것보다 훨씬 더 복잡하다는 것이다. 벌판에서 발견된 비교적 간단한 시계도 지적설계를 추론하기에 충분했다면, 앞에서 기술한 조절되고, 유연하고, 주기적인, 극도로 정교한, 초미세한 생체시계들은 더더욱 우연히 생겨나기 어려운 것들이 아니겠는가?



진화론자들은 의심할 여지없이, 모든 복잡성과 함께 사람의 24시간 생체시계도 진화된 것이라고 주장할 것이다. 일부 초기 미생물은 일주기 활동을 조절하는 것이 유익하다는 것을 알게 되었고, 이후 생물에서 그것은 더 좋아졌고, 장구한 시간이 흐른 후에, 우리 몸에 생체시계가 있게 되었다고 주장할 것이다. 이 주장에 어떻게 반응해야할 지를 생각해 보라. 우리는 앞으로의 자연선택에 대해 더 많은 글들을 게재할 것이지만, 2018. 3. 13일의 글부터 살펴보라 : ”자연선택인가? 아니다. 운자선택이다.” 진화론적 적응이란 무엇인가? 그리고 자연선택(선택은 기존에 있던 것들 중에서 고르는 일)이 새로운 기능이나 기관을 만들어낼 수 있는가? 새로운 기관에 대한 유전정보들은 어떻게 생겨났는가? 정보도 무작위적인 과정으로 생겨날 수 있는가?



번역 - 미디어위원회

링크 - https://crev.info/2018/03/paleys-watch-found/ 

출처 - CEH, 2018. 3. 30.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6838


참고 : 

1. 생체시계의 초고도 복잡성은 창조를 가리킨다. (Circadian Clocks, Genes, and Rhythm)

2. 유전자 시계들은 최근 창조를 가리킨다. : 미토콘드리아 DNA, Y-염색체의 돌연변이 발생률 (Genetic Clocks Verify Recent Creation)

3. 수렴진화는 점점 더 많은 사례에서 주장되고 있다. : 독, 썬크림, 생체시계, 다이빙, 사회성, 경고신호... (More Examples of “Convergent Evolution” Claimed)

4. 빛과 어두움의 창조 리듬과 생체시계

5. 준비, 조준, 개화 : 개화 시간을 알려주는 식물의 시계 (Ready, Aim, Flower)

6. 제왕나비에서 경도 측정 시계가 발견되었다. (Neurobiologists Discover Butterfly Chronometer)

7. 식물들은 모래시계 메커니즘을 사용한다. (Plants Use Hourglass Mechanism)

8. 제왕 나비의 장거리 항해를 도와주는 내부 시계 (Internal Clock Assists Monarch Butterfly‘s GPS)

9. 만우절의 농담과 같은 진화론자의 주장들. :보존된 유전자들, 약자생존, 실러캔스 이야기 (Darwinism as an April Fool Prank)

10. 맬더스와 다윈의 오류, 그리고 사회진화론의 오류. : 조류 종들은 생존경쟁을 하지 않고 있었다. (Malthus Misled Darwin Who Misled the World)

11. 약자생존과 폐기되는 성선택 (Survival of the Weakest)

12. 멋진자 생존 또는 친절자 생존? (Survival of the Nicest)

13. 이러한 것들이 다윈이 생각했던 것인가? : 신중자생존, 속자생존, 순간적 진화, 진화적 관심? (Is This What Darwin Had in Mind?)

14. 진화론은 다윈에 역행하여 가고 있다. : 속자교배, 완자생존, 약자생존, 부적자생존? (Evolution Goes Against Darwin)

15. 심지어 박테리아도 황금률을 따르는 것처럼 보인다. : 이타주의적 행동은 적자생존의 진화론과 모순된다. (Even Bacteria Seem to Follow the Golden Rule)

16. 개는 귀엽게 보이도록 진화했는가? : 귀자생존? (Dogs for Darwin)

17. 숲의 교향곡 (Sylvan symphony) : 식물들은 생존경쟁을 하는 것이 아니라, 서로 돕고 있었다.

18. '적자생존'인가, '운자생존'인가? (Survival of the Fittest - or the Luckiest?)

19. 엔코드 프로젝트에 뒤이은 4D 뉴클레옴 프로젝트는 DNA의 슈퍼-초고도 복잡성을 밝혀낼 것이다. (The 4D Nucleome Project Helps Creationist Research)

20. ‘엔코드’ 연구로 밝혀진 유전체의 초고도 복잡성. : ‘정크 DNA’ 개념의 완전한 몰락 (ENCODE Reveals Incredible Genome Complexity and Function)

21. 유전자의 이중 암호는 진화론을 완전히 거부한다. : 중복 코돈의 3번째 염기는 단백질의 접힘과 관련되어 있었다. (Dual-Gene Codes Defy Evolution...Again)

22. 3차원적 구조의 DNA 암호가 발견되다! : 다중 DNA 암호 체계는 진화론을 기각시킨다. (Three-Dimensional DNA Code Defies Evolution)

23. 후성유전학적 암호는 이전의 생각보다 훨씬 더 복잡했다. (Epigenetic Code More Complicated Than Previously Thought)

24. 후성유전체 연구는 세포에서 교향악단을 발견했다. (Epigenome Project Finds Symphony in Cells)

25. 선도적 과학자들이 진화론을 비판하다. 1부. : 유전정보는 자연주의적 과정으로 생겨날 수 없다. (Powerhouse of Scientists Refute Evolution, Part One)

26. 선도적 과학자들이 진화론을 비판하다. 2부. : 생물학적 정보 생성의 어려움과 컴퓨터 시뮬레이션 (Powerhouse of Scientists Refute Evolution, Part Two)

27. 선도적 과학자들이 진화론을 비판하다. 3부. : 세포 내의 유전정보는 증가되지 않고, 소실되고 있다. (Powerhouse of Scientists Refute Evolution, Part Three)

28. 사람 유전체는 4차원의 세계로 되어 있다. (Human Nucleome Reveals Amazing 4D World)

29. 사람 몸은 머리에서부터 발끝까지 지적설계이다. : 보행, 근육, 태반, 방수, 뇌, 간... (Walk This Way: Body Designs Head to Toe)

30. 지적설계 논쟁이 선도적 무신론자를 하나님께로 인도하였다. : 악명 높았던 무신론자 안토니 플루(Antony Flew)의 회심 (Book : Intelligent Design Argument Turns Leading Atheist to God)

31. 식물의 복잡성은 창조주의 경이로운 설계를 드러내고 있다! (Complex Plant Systems: Rooted in God's Genius)

32. 식물에서 이메일 시스템이 확인되었다! : 이러한 고도의 복잡성은 진화론을 부정한다. (Plant Email System Described)

33. 당신의 첫 호흡은 ‘한 요소도 제거 불가능한 복잡성’이다. (Your First Breath Was Irreducibly Complex)

34. 귀의 경이로운 복잡성이 계속 밝혀지고 있다. 그리고 박쥐에 대항하여 방해 초음파를 방출하는 나방들. (The Parts List for Hearing)

35. 계속 밝혀지고 있는 식물의 고도 복잡성 : 식물의 썬크림, 광 스위치, 변태, 미생물과의 공생 (Plants Are Clever 1)



서울특별시 중구 삼일대로 4길 9 라이온스 빌딩 401호

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 오경숙

사업자번호 : 120-87-70892

통신판매업신고 : 제 2018-서울중구-0764 호

주소 : 서울특별시 중구 삼일대로 4길 9, 라이온스빌딩 401호

대표전화 : 02-419-6484

개인정보책임자 : 김광