태초에 하나님이 천지를 창조하시니라 (창세기 1:1)

LIBRARY

KOREA  ASSOCIATION FOR CREATION RESEARCH

창조설계

David F. Coppedge
2018-01-09

건강은 좋은 바이러스와 미생물에 달려있을 수 있다. 

(Health May Depend on Good Viruses and Microbes)


     인체에 대해 배워야할 것이 아직도 많이 남아 있다. 우리의 가장 친한 친구 중 일부는 우리 자신의 유전자를 공유하지 않을 수도 있다.


좋은 고세균

과학자들은 고세균(Archaea, 고균)이라는 미생물을 가장 원시적 생명체로, 온천과 같은 극한적 환경에 서식하는 생물(extremophiles)로 여기고 있었다. 이제 새롭게 밝혀진 사실에 의하면, 우리 몸 속에도 수많은 고세균들이 있다는 것이다. 그들은 어떻게 여기에 왔으며, 그들은 무엇을 하고 있는가? Science Magazine(2017. 11. 24) 지는 사람 생태계에 살고 있는 이 개척자들로 인해 피곤해하고 있었다. ”신체의 고세균에 대한 조사는 다른 미생물 손님을 밝혀냈다”고 엘리자베스 펜니시(Elizabeth Pennisi)는 말했다.

아마도 가장 고대의 생명체로 여겨지고 있던 고세균을 생각하면, 온천, 알칼리성 호수, 폐수 처리장과 같은 극한의 장소에서 살아갈 것으로 생각될 것이다. 그러나 이 미생물은 때때로 인간의 코, 폐, 내장, 피부에 많은 수로 있다고, 지난 주에 미생물학자들은 보고했다.

mBio 지에 게재된 그들의 조사는, 자연적으로 인체에 서식하면서 건강과 질병에 영향을 미칠 수 있는 다른 미생물들을 찾기 위한, 많은 논의를 거친 미생물군유전체(microbiome)를 구성하는 박테리아 이외의 것들을 찾기 위한 조사의 일부였다 (see p. 982). 프랑스 클레르몽페랑에 있는 클레르몽 오베르뉴(Clermont Auvergne) 대학의 분자생물학자인 장 프랑수아 브루에르(Jean-François Brugère)는 ”사람에서 이처럼 풍부한 고대의 고세균들이 존재한다는 사실은 매우 흥미로운 일이다”라고 말했다. ”사람의 미생물은 박테리아에 국한되어서는 안 된다.”

또 다른 연구자는 그녀가 본 모든 곳에서, 심지어 병원과 우주선의 '클린' 방에서도, 놀랄 만큼 풍부한 고세균들을 발견했다. 그녀는 인체를 살펴보기 시작했고, 사람의 피부, 폐, 코, 내장에서 고세균들을 발견했다. 지금까지 고세균들이 우리의 건강에 어떤 영향을 미치는 지는 명확하지 않다. 그들의 '조직 특이성'(선호하는 위치)은 건강한 상호작용을 가리키는 것처럼 보인다. 한 연구원은 ”이러한 다양성은 우리 몸 내부와 표면에 있었으며, 우리는 그것을 알지 못했다.”라며 경탄했다.

*참조

고세균은 아직도 살아있고, 진화되지 않았다!

20억 년(?) 동안 진화하지 않은 황세균 : 가장 오래된 '살아있는 화석'의 발견에도 진화론은 유지된다.

장내세균과 장의 협력 관계에서 새로운 사실의 발견.

세균의 대사는 컴퓨터 회로판과 같이 작동된다.


좋은 바이러스

고세균 보다 작을 지라도, 박테리오파지(bacteriophages)라 불리는 유익한 바이러스가 인체의 건강에 중요한 역할을 할 수도 있다는 것이다. 이름에서 알 수 있듯이, 박테리오파지는 박테리아를 먹는다. 즉각적으로, 그것은 좋은 소리처럼 들린다. Science Magazine(2017. 11. 24)에서 죠지아(Giorgia Guglielmi)는 ”손님인 박테리오파지는 사람의 건강을 지켜주나요?”라고 묻고 있었다. 그렇다면 그들은 환영받는 손님이다. 그들의 발견에 대한 배경은 다음과 같다 :

박테리오파지, 또는 단순히 파지로 알려진 이 바이러스는 제1차 세계대전 병사들의 배설물에서, 박테리아를 죽이고 있는 것이 발견된 지 1세기 만에, 인체 내에서 어떤 역할을 하고 있을지 새로운 주목을 받고 있다. 파지는 바다에서부터 토양까지 모든 곳에서 발견되어왔다. 이제 한 연구에 따르면, 사람은 매일 장(intestines)을 통해 최대 300억 마리의 파지를 흡수하고 있다.

건강한 사람의 몸에 고세균과 파지가 넘쳐난다는 사실은 그들이 어떻게든 우리를 돕고 있다는 것을 가리킨다. 일부 보건 단체들은 더 많은 파지를 섭취하면, 기생충을 통제하거나, 다른 유익을 얻을 수 있다고 제안했다. ”몇 가지 흥미진진한 성공 사례가 있지만, 파지 치료(phage therapy)가 신뢰할 수 있는 치료법이 되기에는 아직 길이 멀다”고 죠지아는 주의를 주고 있었다. 신체의 '파지옴(phageome)'을 분류하는 작업도 시작되었다. 파지는 점막에서 가장 풍부하게 나타나는데, 그곳은 환경에 노출되어 유해한 박테리아가 축적될 수 있는 곳이다. 또한 새로운 연구 결과는 파지들이 우리의 조직으로 퍼져나갈 수 있음을 보여준다. 몇몇 연구는 우리의 작은 손님들이 유익한 기능을 갖고 있을 수 있다는 단서를 제공해주고 있다 :

만약 파지가 우리의 조직 안으로 들어와 있다면, 그들은 그곳에서 무엇을 하고 있는가? 그들은 거기에서 무엇을 하는가? 단지 일부 연구만이 이 문제를 다루고 있다. 2004년 다브로스카(Dąbrowska)의 연구팀은 특정 종류의 파지가 암세포 막에 결합하여, 생쥐에서 종양의 성장과 확산을 억제하고 있다고 보고했다. 몇 년 후 다브로스카의 지도교수이며 파지 전문가인 Andrzej Górski는 파지가 마우스 면역계 내로 주입됐을 때, T 세포 증식과 항체 생성을 촉진시킬 수 있음을 보여주었다. 생쥐에서 파지는 이식된 장기 조직을 면역계가 공격하는 것을 막을 수도 있었다.

파지는 또한 염증을 감소시키고, 면역계를 조절할 수 있다. '파지옴'이 우리 몸에서 하는 일을 이해하는 데는, 수십 년이 걸릴 수도 있지만, 초기 징후는 긍정적이다.

*관련기사 : 살균 바이러스 ‘파지’ 비밀 밝혀 : 매일 300억 마리 유입, 병원균의 세포막 공격 방어 (2017. 11. 22. ScienceTimes)

*참조

바이러스도 분자 모터들을 가지고 있었다.

바이러스는 바다를 좋게 만들 수 있다.

바이러스는 창조된 것인가, 진화된 것인가?

유전자 무질서도가 증가하고 있다는 실제적 증거들 : 인플루엔자 바이러스에서 돌연변이 축적의 결과



인체 생리학 분야에서 해야 할 일이 많다. 이 기사들 중 어떤 것도 진화를 언급하지 않고 있었다. 고세균 생물학이나, 파지 생물학의 어떤 것도 진화론과 상관없는 것으로 보인다. 폴 넬슨(Paul Nelson)의 말처럼, 우리는 지적설계에 의한 접근을 제안한다. ”무언가가 작동되고 있다면, 그것은 우연히 일어나지 않았을 것이다.” 다윈의 안경을 벗고, 이 새로운 연구 분야를 살펴보라. ”한 요소도 제거 불가능한 복잡성(irreducibly complex, 환원 불가능한 복잡성)”에 대한 추가적 도움을 받을 수 있을 것이다.



번역 - 미디어위원회

링크 - https://crev.info/2017/11/health-may-depend-good-viruses-microbes/

출처 - CEH, 2017. 11. 30.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6760


참고 :

1. 지구에는 막대한 수의 박테리아들이 존재한다. (Bacteria Rule the Earth)

2. 미생물도 의사소통을 하고 있었다! (Microbes Talk More than People Do)

3. 동물성 플랑크톤에서 발견된 다연발의 작살! : 하등하다는 원생동물에서 고도로 복잡한 기관의 발견 (Lowly Plankton Packs High-Caliber Heat)

4. 하등하다고 주장되는 생물들이 어떻게 첨단 물리학을 알고 있는가? (How Did Primitive Organisms Learn Physics?)

5. 생물들의 놀라운 기술과 생체모방공학 : 이러한 기술들이 모두 우연히 생겨났을까? (Inspiring Life Tricks)

6. 생체시계의 초고도 복잡성은 창조를 가리킨다. (Circadian Clocks, Genes, and Rhythm)

7. 생명체의 본질로서 정보 통신 (Life as the Communication of Information)

8. 토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. (Iron-mining Fungus Displays Surprising Design)

9. 박테리아의 놀라운 빛 감지 능력 : 렌즈와 같은 세포 (The Crawling Eye: Cells as Lenses)

10. 세포가 저절로 만들어졌다고?

11. 세포의 미토콘드리아 세망은 도시 전력망을 닮았다. (Cell Feature Resembles Power Grid)

12. ‘최적화의 실패’로 살아남은 효모 (Yeast Survive as They 'Fail to Optimize')

13. 자연이 38억 년 동안 연구개발을 했는가? : 생체모방공학의 계속되는 성공 - 해바라기, 규조류, 식물 의약품... (Nature : 3.8 Billion Years of R&D)

14. 새로운 분자 모터 클러치가 발견되었다. (Scientists Discover New Molecular Motor 'Clutch')

15. 생물에서 발견되는 경이로운 기술들 : 나비 날개의 광흡수, 소금쟁이의 부양성, 생물학적 배터리 (From Wonders of Nature to Wonders of Technology)

16. 분별없이 박테리아를 미워하지 말라! (Don’t Hate Bacteria Irrationally)

17. 박테리아가 노화에 저항하는 독창적인 방법 (The Ingenious Way That Bacteria Resist Aging)

18. 바이러스는 창조된 것인가, 진화된 것인가? (Were Viruses Created or Evolved?)

19. 단순한(?) 아메바가 박테리아를 사육하고 있었다. ('Simple' Amoebas Can Farm Bacteria)

20. 점균류의 네트워크는 철도 시스템을 능가하고 있었다. (Slime Networks Are Better Organized than Railway Systems)

21. 규조류를 이용한 고효율 태양전지 (Better Solar Cells with Diatoms)

22. 세상에서 가장 작은 나침반 : 보잘 것 없는 박테리아도 방향을 감지할 수 있었다. (The world’s smallest compasses)

23. 아무것도 아닌 것들 : 미세세계에서 보여지는 놀라운 창조의 증거들 (The things that are not)

24. 포자 내부에는 나노 기술이 들어있다. (What's Inside a Spore? Nanotechnology)

25. 이 세균은 탱크처럼 이동한다. (This Bacterium Moves Like a Tank)

26. 세포들은 그들의 신체 위치를 결정하는 데에 우편번호를 사용한다. (Cells Use Zip Codes to Determine Their Body Location)

27. 세균의 편모 : 고도로 복잡한 초미세 구조가 우연히? (Evolution of the Flagellum : And the Climbing of ‘Mt. Improbable’)

28. 작동 중인 분자기계 리보솜을 보라. (Watch a Ribosome in Action)

29. 박테리아 편모의 모터는 단백질 클러치를 가지고 있었다. (Bacterial Flagellar Motor Has a Protein Clutch) 

30. 균류에 있는 가장 빠른 분사기 (Fastest Squirt Gun in the Fungi)

31. 스트레소좀 : 박테리아의 정교한 대처 메커니즘 (Stressosomes: Bacteria's Ingenious Coping Mechanism)

32. 자기희생 세포들은 자신을 내어주신 설계자를 증거한다. (Self-sacrificing Cells Demonstrate a Selfless Designer)

33. 세포의 분자 모터들은 함께 협력해서 작동한다. (Cell Motors Play Together)

34. 단순한 생물체 같은 것은 없다. (There’s No Such Thing as a ‘Simple’ Organism)

35. 효소는 진화할 수 없었음을 새로운 연구는 보여주었다. (New Study Shows Enzymes Couldn't Evolve)

36. 나노기술과 창조주

37. 바이러스는 바다를 좋게 만들 수 있다. (Viruses May Do the Ocean Good)

38. 가장 오래된 결핵이라는 주장 : 결핵도 보시기에 심히 좋으셨던 창조의 한 부분인가? (Oldest tuberculosis claim : Was TB part of the original very-good creation?)

39. 창조, 타락, 그리고 콜레라 (Creation, Corruption, and Cholera)

40. 하나님이 에볼라 바이러스도 만드셨는가? (Did God Make the Ebola Virus?)

41. ‘엔코드’ 연구로 밝혀진 유전체의 초고도 복잡성. : ‘정크 DNA’ 개념의 완전한 몰락 (ENCODE Reveals Incredible Genome Complexity and Function)

42. DNA에서 제2의 암호가 발견되었다! 더욱 복잡한 DNA의 이중 언어 구조는 진화론을 폐기시킨다. (Two Genetic Codes Is Better Than One)

43. 듀온 : DNA의 이중 암호는 진화론을 거부한다. (Duons: Parallel Gene Code Defies Evolution)

44. 유전자의 이중 암호는 고도의 지적설계를 가리킨다. (Dual-Gene Code Discovery Highlights Designed Biocomplexity)

45. 유전자의 이중 암호는 진화론을 완전히 거부한다. : 중복 코돈의 3번째 염기는 단백질의 접힘과 관련되어 있었다. (Dual-Gene Codes Defy Evolution...Again)

46. 섬모충의 유전체는 극도로 복잡했다. 2 : 유전체의 스크램블링과 암호화는 진화론을 거부한다. (Genome Scrambling and Encryption Befuddles Evolution)

47. 꿀벌의 고아유전자는 진화론을 쏘고 있었다. : 진화적 조상 없이 갑자기 등장하는 독특한 유전자들. (Honey Bee Orphan Genes Sting Evolution)

48. 후성유전체 연구는 세포에서 교향악단을 발견했다. (Epigenome Project Finds Symphony in Cells)

49. RNA 편집 : 새로운 차원의 초고도 생물복잡성 (RNA Editing: Biocomplexity Hits a New High)

50. ‘수평 유전자 전달’이라는 또 하나의 진화론적 신화 (Another Horizontal Gene Transfer Fairy Tale)

51. 사람 유전체는 4차원의 세계로 되어 있다. (Human Nucleome Reveals Amazing 4D World)

52. 2015년 노벨 화학상으로 부각된 세포의 DNA 손상 복구 메커니즘은 진화론을 거부한다. (2015 Nobel Prize Highlights Cell Repair Mystery)

53. 사람과 침팬지의 유전자 차이는 더욱 커졌다. : 각 생물에만 있는 고아유전자들은 진화론을 거부한다. (Genetic Gap Widens Between Humans and Chimps)

54. 후성유전학적 암호는 이전의 생각보다 훨씬 더 복잡했다. (Epigenetic Code More Complicated Than Previously Thought)

55. 유전체 내 바이러스성 정크의 기능이 발견되다. (Viral Genome Junk Hits the Trash)

56. 정크 DNA가 기능이 있음이 또 다시 확인되었다. : 모티프라 불리는 DNA의 직렬반복과 유전자 발현 (Junk DNA…Trashed Again)

57. 3차원적 구조의 DNA 암호가 발견되다! : 다중 DNA 암호 체계는 진화론을 기각시킨다. (Three-Dimensional DNA Code Defies Evolution)

58. 내부 텔로미어로 보이는 염기서열은 풍부하고 기능적이다. (Internal Telomere-like Sequences Are Abundant and Functional)

59. 4차원으로 작동되고 있는 사람 유전체 : 유전체의 슈퍼-초고도 복잡성은 자연주의적 설명을 거부한다. (The four dimensional human genome defies naturalistic explanations)

60. 유전자 코돈에서 중복/퇴화라는 개념의 몰락 (Codon Degeneracy Discredited Again)

61. 생명정보의 비밀

62. 위-위유전자는 진화론 패러다임을 뒤흔들고 있다. (Pseudo-Pseudogenes Shake Up Evolutionary Paradigm)

63. 엔코드 프로젝트에 뒤이은 4D 뉴클레옴 프로젝트는 DNA의 슈퍼-초고도 복잡성을 밝혀낼 것이다. (The 4D Nucleome Project Helps Creationist Research)

64. 정크 DNA에서 발견된 경이로운 기능 : 정확한 위치로 분자 화물을 유도하는 항로 표지자 (Pinpoint Navigation and Propulsion in a Seemingly Random Soup)

65. 산호에서 발견된 RNA 편집은 진화론과 모순된다. : RNA 편집이라는 초고도 복잡성이 다양한 생물들에 있었다! (RNA Editing in Corals Stupefies Evolution)

David F. Coppedge
2018-01-03

지구에는 막대한 수의 박테리아들이 존재한다. 

(Bacteria Rule the Earth)


      세균(bacteria)은 피할 수 없다. 그들은 어디에나 있다. 다행히도 많은 수가 좋은 것들이다.

얼마나 많은 세균들이 한 알의 모래 속에 거주하는지 짐작이 되는가? 맥스 플랑크 연구소(Max Planck Institute, 2017. 12. 5)에 따르면, 모래알은 아주 작은 생명체들에게는 대도시라는 것이다. ”한 알의 모래에는 수천 종의 최대 100,000마리의 미생물들이 서식하고 있다.” 당신이 방문하는 해변은 결코 동일하지 않다. 당신이 모래에 앉거나, 모래성을 만들거나, 모래찜질을 할 때, 세균들이 올라오게 된다. 그러나 걱정하지 마라. 그들은 좋은 세균이다. 그들은 바다를 깨끗하게 유지하고, 지구의 질소순환과 탄소순환을 유지하는 것을 도와줌으로써, 당신과 전 세계를 돕고 있다.

모래에 거주하는 박테리아들은 해양 생태계와 지구 물질 순환에 중요한 역할을 한다. 이러한 박테리아들은 바닷물이나 하천에서 유입되는 탄소와 질소 화합물을 처리하기 때문에, 모래는 막대한 정화용 필터 역할을 하고 있는 것이다. 바닷물에 의해 해저에 쓸려간 것들의 대부분은 되돌아오지 않는다.

”매 모래 알갱이들은 작은 박테리아들의 저장고와 같은 기능을 한다”라고 프로반트(Probandt)는 설명한다. 그들은 탄소, 질소 및 황의 순환을 유지하기 위해 필요한 공급량을 제공한다. ”모래 알갱이에 거주하는 박테리아 집단이 노출된 상황이 무엇이든지 간에, 박테리아 집단의 엄청난 다양성 덕분에, 주변 물에 있는 오염물질들을 항상 처리할 수 있다.”

남극 대륙으로 여행을 간다면, 세균을 피할 수 있을 것이라고 당신은 생각할 수도 있다. 정말 세균을 만나지 않을까? 아니다. 튀빙겐(Tübingen. 2017. 12. 13) 대학의 지구 과학자들은 작은 세계여행가들이 그곳에서도 당신을 맞이할 것이라고 말한다. 놀랍게도 동일한 종류의 박테리아가 양 극지방에서 산다. 이것은 그들이 새나, 사람에 의해서, 어쩌면 대기를 통해서, 전 세계로 이동된다는 것을 의미한다. Evolution News & Science Today(2017. 8. 23) 지에 실린 기사에 따르면, 세계 여행이 가능한 한 가지 방법은 먼지 입자로 구름에 들어가는 것이다. 박테리아는 전 세계를 여행하는 작은 먼지에 붙어서 살 수 있다.

1 ml 당 100~1,000마리의 진핵세포와 1,000~10,000마리의 박테리아 및 고세균이 있다. 이러한 수치는 이전 관측치를 훨씬 초과하는 것이다. ”구름은 극도로 풍부하고 다양한 출처의 생태계에 있던 미생물들을 갖고 있다”라고 연구자들은 말한다.

Evolution News & Science Today(2017. 9. 26)의 또 다른 기사에서, 연구자들은 당신의 발아래 먼지를 조사하고 있었다. 사막의 지표면에는 광합성 미생물이 포함되어있어서, 유기체 전체 집단을 지원해주고 있다는 연구 결과가 나왔다. 그들 중 일부는 모래와 토양의 정전기를 줄이는 역할을 담당하고 있을 수도 있다. 그 기능이 없다면, 지구의 표면은 화성과 타이탄에서처럼, 거주하기 어려울 수 있다고 이 기사는 말한다.

이제 우리는 우리를 둘러싸고 있는 보이지 않는 생명체 형태에 대한 존경심을 가져야만 한다. 이들은 원시적이고, 쓸모없는 세균들이 아니다. 그들은 주변 환경을 탐사하기 위해서, 환경을 감지할 수 있다고, 바르셀로나 대학(University of Barcelona. 2017. 12. 12)의 보도 자료는 말하고 있었다. 이것은 신체의 조직 세포에서도 마찬가지이다. 눈이 없지만, 세포들은 알고 있다. Nature(2017. 12. 6) 지에 실린 논문은, '부하력(force loading)'이 어떻게 세포에 공간적 감각을 부여하는지 설명하고 있다. 언론 보도는 이것은 당신 주위에서 그들의 얼굴로 느끼며 ”보고 있는” 생명체로 비유하고 있었다.

뮌헨 공과 대학교(University of Munich, 2017. 12. 13)의 실험은, 박테리아가 주변 환경에 적응하는 방법을 보여주고 있었다. 음식이 부족하거나 풍부할 때, 유기체는 그들이 생산하는 소화효소의 수를 능동적으로 조절하여, 소화 시스템을 적응시킨다. 세포는 주변 환경을 감지하고, 움직이고, 적응할 수 있다. 모래와 돌은 주변 환경을 탐사하거나 감지하지 못한다. 이러한 능력은 이러한 과정을 의도적으로 수행할 수 있는 분자기계들을 만들어내기 위한 암호화된 정보를 필요로 한다.

*참조 : 박테리아의 놀라운 빛 감지 능력 : 렌즈와 같은 세포

4차원으로 작동되고 있는 사람 유전체 : 유전체의 슈퍼-초고도 복잡성은 자연주의적 설명을 거부한다.

경탄스런 극소형의 설계 : DNA에 집적되어 있는 정보의 양

또한 과학자들은 처음으로 극지방의 얼음과 눈 속에서 살아있는 박테리아를 직접 관찰했다 (Science Daily, 2017. 12. 20). ”처음으로 과학자들은 무균인 것으로 간주됐던 극지방의 얼음과 눈에서 살아있는 박테리아를 직접 관찰했다.” 켈리(Kelly Redeker) 박사는 말했다. ”가장 깨끗할 것으로 여겼던 극지방의 얼음과 눈에서 대사적으로 활발한 박테리아를 관찰했다는 사실은, 존재할 수 없다고 생각하는 환경에서도 생명체가 증식할 수 있다는 신호이다.”



지구는 암호화된 정보로 가득하다. 지구에 있는 수많은 모래 알갱이들과, 거기에 존재하는 수많은 박테리아들이 그 안에 모두 유전정보를 갖고 있는 것을 생각해 보라. 그리고 바다에 있는 수많은 플랑크톤, 해조류, 바다생물들, 육상에 있는 수많은 동식물들의 엄청난 수의 각 세포마다 들어 있는 막대한 량의 유전정보를 생각해 보라. 그리고 이러한 막대한 암호화된 정보들은 모두 어디에서 왔는가? 이러한 막대한 량의 유전정보들이 모두 무작위적인 돌연변이들로 각 생물마다 완벽하게 생겨났는가? 이 무슨 우스꽝스러운 개념인가? 우리가 알고 있는 유일한 이유는 지성(intelligence)이다. 박테리아는 해저에서도 살아가며, 주변 물로 전기를 전도할 수도 있다(11/10/2012). 또한 6/06/2014에 보고했던 것처럼, 그것은 지구가 생물들이 거주할 수 있는 환경이 되기 때문이다.


더 많은 이 세계의 경이로움을 알기 원하면, 새로 나온 책 ”지구라는 우주선: 승객을 위한 안내서(Spacecraft Earth: A Guide for Passengers)”를 읽어 보라. 놀라운 사실을 담고 있는 이 책은 a Sneak Peek available from the Publisher, Creation Ministries International로 들어가면 약 30페이지를 무료로 간단히 살펴볼 수 있다.



번역 - 미디어위원회

링크 - https://crev.info/2017/12/bacteria-rule-earth/

출처 - CEH, 2017. 12. 14.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6756


참고 :

1. 세상에서 가장 작은 나침반 : 보잘 것 없는 박테리아도 방향을 감지할 수 있었다. (The world’s smallest compasses)

2. 아무것도 아닌 것들 : 미세세계에서 보여지는 놀라운 창조의 증거들 (The things that are not)

3. 포자 내부에는 나노 기술이 들어있다. (What's Inside a Spore? Nanotechnology)

4. 이 세균은 탱크처럼 이동한다. (This Bacterium Moves Like a Tank)

5. 세포들은 그들의 신체 위치를 결정하는 데에 우편번호를 사용한다. (Cells Use Zip Codes to Determine Their Body Location)

6. 세균의 편모 : 고도로 복잡한 초미세 구조가 우연히? (Evolution of the Flagellum : And the Climbing of ‘Mt. Improbable’)

7. 작동 중인 분자기계 리보솜을 보라. (Watch a Ribosome in Action)

8. 박테리아 편모의 모터는 단백질 클러치를 가지고 있었다. (Bacterial Flagellar Motor Has a Protein Clutch) 

9. 균류에 있는 가장 빠른 분사기 (Fastest Squirt Gun in the Fungi)

10. 스트레소좀 : 박테리아의 정교한 대처 메커니즘 (Stressosomes: Bacteria's Ingenious Coping Mechanism)

11. 바이러스도 분자 모터들을 가지고 있었다. (Virus Motors Impossible for Evolution)

12. 자기희생 세포들은 자신을 내어주신 설계자를 증거한다. (Self-sacrificing Cells Demonstrate a Selfless Designer)

13. 세포의 분자 모터들은 함께 협력해서 작동한다. (Cell Motors Play Together)

14. 규조류를 이용한 고효율 태양전지 (Better Solar Cells with Diatoms)

15. 단순한 생물체 같은 것은 없다. (There’s No Such Thing as a ‘Simple’ Organism)

16. 점균류의 네트워크는 철도 시스템을 능가하고 있었다. (Slime Networks Are Better Organized than Railway Systems)

17. 자연이 38억 년 동안 연구개발을 했는가? : 생체모방공학의 계속되는 성공 - 해바라기, 규조류, 식물 의약품... (Nature : 3.8 Billion Years of R&D)

18. 단순한(?) 아메바가 박테리아를 사육하고 있었다. ('Simple' Amoebas Can Farm Bacteria)

19. 박테리아가 노화에 저항하는 독창적인 방법 (The Ingenious Way That Bacteria Resist Aging)

20. 효소는 진화할 수 없었음을 새로운 연구는 보여주었다. (New Study Shows Enzymes Couldn't Evolve)

21. 나노기술과 창조주

22. 분별없이 박테리아를 미워하지 말라! (Don’t Hate Bacteria Irrationally)

23. 새로운 분자 모터 클러치가 발견되었다. (Scientists Discover New Molecular Motor 'Clutch')

24. 바이러스는 바다를 좋게 만들 수 있다. (Viruses May Do the Ocean Good)

25. 세균의 대사는 컴퓨터 회로판과 같이 작동된다. (Bacteria Metabolisms Are Like Computer Circuit Boards)

26. 세포의 미토콘드리아 세망은 도시 전력망을 닮았다. (Cell Feature Resembles Power Grid)

27. 세포가 저절로 만들어졌다고?

28. 박테리아의 놀라운 빛 감지 능력 : 렌즈와 같은 세포 (The Crawling Eye: Cells as Lenses)

29. 토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. (Iron-mining Fungus Displays Surprising Design)

30. 생명체의 본질로서 정보 통신 (Life as the Communication of Information)

31. 동물성 플랑크톤에서 발견된 다연발의 작살! : 하등하다는 원생동물에서 고도로 복잡한 기관의 발견 (Lowly Plankton Packs High-Caliber Heat)

32. 미생물도 의사소통을 하고 있었다! (Microbes Talk More than People Do)

33. 가장 오래된 결핵이라는 주장 : 결핵도 보시기에 심히 좋으셨던 창조의 한 부분인가? (Oldest tuberculosis claim : Was TB part of the original very-good creation?)

34. 창조, 타락, 그리고 콜레라 (Creation, Corruption, and Cholera)

35. 하나님이 에볼라 바이러스도 만드셨는가? (Did God Make the Ebola Virus?)

36. ‘엔코드’ 연구로 밝혀진 유전체의 초고도 복잡성. : ‘정크 DNA’ 개념의 완전한 몰락 (ENCODE Reveals Incredible Genome Complexity and Function)

37. DNA에서 제2의 암호가 발견되었다! 더욱 복잡한 DNA의 이중 언어 구조는 진화론을 폐기시킨다. (Two Genetic Codes Is Better Than One)

38. 듀온 : DNA의 이중 암호는 진화론을 거부한다. (Duons: Parallel Gene Code Defies Evolution)

39. 유전자의 이중 암호는 고도의 지적설계를 가리킨다. (Dual-Gene Code Discovery Highlights Designed Biocomplexity)

40. 유전자의 이중 암호는 진화론을 완전히 거부한다. : 중복 코돈의 3번째 염기는 단백질의 접힘과 관련되어 있었다. (Dual-Gene Codes Defy Evolution...Again)

41. 섬모충의 유전체는 극도로 복잡했다. 2 : 유전체의 스크램블링과 암호화는 진화론을 거부한다. (Genome Scrambling and Encryption Befuddles Evolution)

42. 꿀벌의 고아유전자는 진화론을 쏘고 있었다. : 진화적 조상 없이 갑자기 등장하는 독특한 유전자들. (Honey Bee Orphan Genes Sting Evolution)

43. 후성유전체 연구는 세포에서 교향악단을 발견했다. (Epigenome Project Finds Symphony in Cells)

44. RNA 편집 : 새로운 차원의 초고도 생물복잡성 (RNA Editing: Biocomplexity Hits a New High)

45. ‘수평 유전자 전달’이라는 또 하나의 진화론적 신화 (Another Horizontal Gene Transfer Fairy Tale)

46. 사람 유전체는 4차원의 세계로 되어 있다. (Human Nucleome Reveals Amazing 4D World)

47. 2015년 노벨 화학상으로 부각된 세포의 DNA 손상 복구 메커니즘은 진화론을 거부한다. (2015 Nobel Prize Highlights Cell Repair Mystery)

48. 사람과 침팬지의 유전자 차이는 더욱 커졌다. : 각 생물에만 있는 고아유전자들은 진화론을 거부한다. (Genetic Gap Widens Between Humans and Chimps)

49. 후성유전학적 암호는 이전의 생각보다 훨씬 더 복잡했다. (Epigenetic Code More Complicated Than Previously Thought)

50. 유전체 내 바이러스성 정크의 기능이 발견되다. (Viral Genome Junk Hits the Trash)

51. 정크 DNA가 기능이 있음이 또 다시 확인되었다. : 모티프라 불리는 DNA의 직렬반복과 유전자 발현 (Junk DNA…Trashed Again)

52. 3차원적 구조의 DNA 암호가 발견되다! : 다중 DNA 암호 체계는 진화론을 기각시킨다. (Three-Dimensional DNA Code Defies Evolution)

53. 내부 텔로미어로 보이는 염기서열은 풍부하고 기능적이다. (Internal Telomere-like Sequences Are Abundant and Functional)

54. 4차원으로 작동되고 있는 사람 유전체 : 유전체의 슈퍼-초고도 복잡성은 자연주의적 설명을 거부한다. (The four dimensional human genome defies naturalistic explanations)

55. 유전자 코돈에서 중복/퇴화라는 개념의 몰락 (Codon Degeneracy Discredited Again)

56. 생명정보의 비밀

57. 위-위유전자는 진화론 패러다임을 뒤흔들고 있다. (Pseudo-Pseudogenes Shake Up Evolutionary Paradigm)

58. 엔코드 프로젝트에 뒤이은 4D 뉴클레옴 프로젝트는 DNA의 슈퍼-초고도 복잡성을 밝혀낼 것이다. (The 4D Nucleome Project Helps Creationist Research)

59. 정크 DNA에서 발견된 경이로운 기능 : 정확한 위치로 분자 화물을 유도하는 항로 표지자 (Pinpoint Navigation and Propulsion in a Seemingly Random Soup)

60. 산호에서 발견된 RNA 편집은 진화론과 모순된다. : RNA 편집이라는 초고도 복잡성이 다양한 생물들에 있었다! (RNA Editing in Corals Stupefies Evolution)

61. 영구동토층에서 다시 살아난 거대 바이러스. (Giant Virus Rises from the Past)

62. 화석은 오랜 시간에 걸친 느리고 점진적인 퇴적을 거부한다. : 고래 화석과 부활한 바이러스에 대한 진화 이야기. (Fossils Defy Slow, Gradual Deposition Over Long Ages)

63. 소금의 전설 (Salty saga) : 2억5천만 년 전(?) 소금에서 다시 살아난 박테리아

64. 그린란드 빙하에서 부활한 박테리아 (Bacteria Resurrected from Greenland Glacier)

David F. Coppedge
2017-09-21

하등하다고 주장되는 생물들이 어떻게 첨단 물리학을 알고 있는가? 

(How Did Primitive Organisms Learn Physics?)


     탄도학, 토목공학, 건축공학에 대한 영감을 줄 수 있는 사례들이 가장 단순한 생물들에서 발견되고 있다.


균류의 탄도학(ballistics). 사람들이 ”우리 중에 곰팡이(fungus, 균류. 사상균이나 효모나 버섯 등을 포함)가 있다”고 말할 때, 그 말은 대게 칭찬으로 사용되지 않는다. 그러나 포자(spores)를 발사하기 위해 갖고 있는 그들의 대포를 본다면 아마도 생각이 바뀔 것이다. New Scientist(2017. 7. 26) 지는 버섯의 대포가 빗방울(raindrops)에 의해서 방아쇠가 당겨지는 것은 정말로 멋진 방법이라고 말하고 있었다. 최근에 노스캐롤라이나 대학의 과학자들이 이 비밀을 이해할 때까지, 이 비밀은 한 세기 동안 완전히 설명되지 못했던 것이라고 레아 크레인(Leah Crane)은 보도했다.

생물학자들은 버섯의 발사 메커니즘은 반-계란(half-egg) 모양의 포자와 상호작용하는 두 방울의 물방울, 즉 평탄한 면 위에 형성된 길쭉한 한 방울과, Buller’s drop라 불리는 포자의 둥근 기저부 근처에 놓여있던 작은 구형의 물방울이 관여한다는 것을 알게 되었다....

두 물방울이 합쳐지면, 표면적의 손실은 원래의 방울에서 표면장력을 유지하고 있던 에너지의 일부를 방출시킨다. 그 에너지는 부모 버섯에서 포자를 멀리 내보내는데 필요한 운동에너지로 변환된다.

이 비밀은 자가-청소(self-cleaning)가 되는 표면을 만드는데 응용될 수 있다고 크레인은 말한다. Phys.org(2017. 7. 24) 지는 곰팡이의 또 다른 비밀을 보도하고 있었다. 다른 유기체들이 그 에너지원을 활용할 방법을 찾지 못했을 때, 목재부후균(wood rot fungi)은 어떻게 나무를 소비할 수 있는 방법을 갖게 되었는가? 그들은 효소가 아니라, 기본적으로 화학을 사용하는, '바이오매스 전환(biomass conversion)'을 사용하고 있었다.(효소들이 만들어지고 그 과정에 사용되지만).  킬레이트화제(chelators)가 세포벽 안으로 들어가 세포벽을 부수어서, 곰팡이는 좋은 재료에 도달하게 되고 그것을 먹을 수 있게 된다. 자넷 라스롭(Janet Lathrop)은 곰팡이가 숲 생태계에 얼마나 중요한지에 대해서 이야기하고 있었다.


해면동물의 토목공학. 진화론자들에 의해서 하등한 생물이라고 말해지는, 해면동물(sea sponges)은 공학자들에게 영감을 줄 수 있는 것이 없어 보인다. 그러나 Phys.org(2017. 8. 4) 지의 한 기사는 해면동물을 다시 보게 만들고 있었다. ”자연에서 믿어지지 않는 토목기사인, 해면동물로부터 배우게 된 새로운 기술”. The Conversation(2017. 8. 4) 지의 한 기사는, 해면동물이 강도(strength)와 경량화(light weight) 사이에서 바람직한 균형을 이루고 있는 방법을 설명하고 있었다.

.비너스의 꽃바구니(Venus Flower Basket), Credit: Kesari Lab/Brown University

부드럽고 질퍽한 주방 스폰지와는 달리 내가 연구하는 해양 스폰지인 유플레크텔라 아스페르길룸(Euplectella aspergillum, 비너스의 꽃바구니)은 뻣뻣하고 강하다. 그것은 놀랍게도 복잡한 골격을 가지고 있는데, 이는 사람의 머리카락보다 굵지 않은, 침골(spicules)로 알려진 복잡한 섬유 집합체로 이루어져 있다. 그것의 구조적 기능은 에펠탑을 구성하는 수천 개의 빔(beams)과 매우 흡사하다.

그는 단순해 보이는 해면동물에 대해 감탄하면서, 자연선택에 대한 이야기를 길게 하고 있었다. ”자연선택을 통해, 더 나은 디자인을 가진 생물은 더 나쁜 디자인을 가진 것보다 오래 살고, 그 디자인의 청사진을 유전자를 통해 후손들에게 넘겨준다.” 독자들이 그의 말을 믿지 않을 것이라고 생각하는지, 그는 이것을 강조하고 있었다.

단백질 건축가. 단백질들은 생물 세포를 구성하는 단지 일부분의 구성요소이다. 그러나 그들은 건축의 대가이다. 그들은 신경세포에서는 클라스린(clathrin) 케이지를 만들고, 바이러스(생물도 아닌)에서는 DNA를 20면체 용기로 단단히 포장한다. PNAS 지는 ”구형 껍질의 단백질 패킹에서 20면체 대칭(icosahedral symmetry)을 넘어서는”이라는 제목의 논문에서, 이러한 초소형 기계들이 어떻게 작동되는지를 이해하는 것은 중요하다고 설명하고 있었다 :

현미경 스케일로 인공구조물의 설계와 제작은 현대 나노기술(nanotechnology)의 핵심 목표 중 하나이다. 자연에서 영감을 받아, 최근에 준-구형의 껍질 또는 케이지 내에서 합성생물학적 빌딩블록이 자가-조립(self-assemble)되는 것을 설계해왔다. 많은 천연단백질 빌딩블록들이 고도로 대칭적인 질서정연한 껍질(예: 바이러스) 내에서 자가-조립되는 반면, 우리의 연구는 합성 빌딩블록에서 작은 (불가피한) 유연성이 놀랍게도 안정적인 무질서한 배치를 유도한다는 것을 보여주었다. 우리의 연구는 구성 요소의 유연성을 조정하면, 패킹의 규칙성을 제어할 수 있으며, 결과적으로 합성 케이지의 표면 특성을 제어할 수 있다는, 새로운 설계 패러다임을 제공하고 있다.

저자들은 ”그 유연성을 최적화하는 것이 표면 특성을 완벽하게 제어할 수 있는, 규칙적인 합성케이지를 얻는 가능한 설계 전략이 될 수 있음”을 발견했다는 것이다.



최고의 과학자들이 복제하기를 원하는 경이로운 기술들이 어떻게 하등하다고 말해지는 원시 생물들에 들어있는 것인가? 이러한 고도의 첨단 기술이 무작위적인 방법으로 모두 우연히 생겨났는가? 도브잔스키는 생물학에서 진화의 개념을 빼면, 의미가 있는 것은 아무 것도 없다고 말했었다. 생물학에서 지적설계를 빼면, 의미가 있는 것은 아무 것도 없다.



번역 - 미디어위원회

링크 - https://crev.info/2017/08/primitive-organisms-learn-physics/ 

출처 - CEH, 2017. 8. 26.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6692


참고 : 

1. 해면동물은 내부 조명으로 광섬유를 사용한다. (Sponges Use Fiber Optics for Interior Lighting) 

2. 환상적 광섬유인 해면동물의 침골 (Fantastic fibre-optics—sponge’s super spicules)

3. 최초의 동물은 해면동물인가, 빗해파리인가? (Evolutionists Rattled Over Battle for Earliest Animal)

4. 우리의 위대한 조상은... 해면? (Our Great Ancestors Were. . . Sponges?)

5. 해면동물은 신경을 발명했는가? (Did Sponges Invent Nerves?)

6. 진핵생물 곰팡이는 24억 년 전에도 존재했다? (Bubbles Scream Life)

7. 토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. (Iron-mining Fungus Displays Surprising Design)

8. 식물은 땅속의 ‘곰팡이 인터넷’을 사용하여 통신을 한다. (Plants Use Underground 'Fungal Internet' to Communicate)

9. 곰팡이의 RNA 접합 메커니즘은 진화론에 타격을 가하다. (Unique Fungal RNA Splicing Mechanism Strikes a Blow Against Darwinian Evolution)

10. 곰팡이의 계통나무는 진화의 문제점들을 확인하였다. (Fungal family tree identifies problems with evolution)

11. 튀겨나감의 성공 : 균류들의 놀라운 분산 방법 (Splashing success)

12. 균류에 있는 가장 빠른 분사기 (Fastest Squirt Gun in the Fungi)

13. 중력보다 600 배 빠른 식물의 신비 (Plant Accelerates 600 G's)

14. 식물이 씨앗을 퍼뜨리는 놀라운 방법들 (Plants Borrow Their Transportation)

15. 점균류의 네트워크는 철도 시스템을 능가하고 있었다. (Slime Networks Are Better Organized than Railway Systems)

16. 나무를 썩게 하는 균류의 이용. (The Uses of Wood Rot)

17. 풀산딸나무 화분의 경이로운 폭발! : 투석기와 유사한 발사 장치는 설계를 가리킨다. (Bunchberry bang!)

18. 단지 복잡한 것 이상의 특수한 복잡성 : 샤프로닌과 같은 단백질이 우연히 생겨날 수 있을까? (More Than Just 'Complex')

19. 다목적의 식물 센서는 과학자들을 당황시키고 있다 : 빛을 감지하는 파이토크롬 단백질은 온도도 감지한다. (Multipurpose Plant Sensors Startle Scientists)

20. 세포 내의 고속도로에서 화물을 운반하는 단백질 키네신 : 이 고도로 정교하고 효율적인 분자 기계가 우연히? (Molecular Highway Motor Comes into Focus)

21. DNA 수선은 팀웍을 필요로 한다. : DNA 사슬간 교차결합의 수선에 13개의 단백질들이 관여한다. (DNA Repair Requires Teamwork)

22. 단백질이 진화될 수 없음을 밝힌 한 새로운 연구 : 단백질은 돌연변이들로 개선될 수 없다. (Study Shows Proteins Cannot Evolve)

23. 진화의 증거는 단지 가정된 것임을 실험 연구는 보여준다. : 단백질은 조금씩의 변화로 다른 단백질이 될 수 없다. (Lab Studies Show Evolutionary 'Evidence' Is Merely Assumed)

24. 단백질들의 빅뱅? : 복잡한 단백질들과 유전정보가 갑자기 모두 우연히? (Shedding Light on the Protein Big Bang Theory)

25. 박테리아 편모의 모터는 단백질 클러치를 가지고 있었다. (Bacterial Flagellar Motor Has a Protein Clutch) 

26. 단백질들은 매듭을 묶을 수 있다. (Proteins Can Tie Knots) 

27. 창고기에서 산호에 있는 녹색 형광 단백질이 발견되었다. : 수억 년이 분리된 생물에서 동일한 물질이 두 번 생겨났다? (Amphioxus Is Green, Like Coral)

28. 가장 작은 세포도 예상했던 것보다 훨씬 복잡하다. : 마이코플라즈마는 387 개의 단백질이 필수적이었다. (Minimal Cell More Complex Than Expected)

29. 닭이 먼저인가, 달걀이 먼저인가? DNA와 단백질 중에 무엇이 먼저인가? (The Chicken or the Egg? DNA or Protein? What came first?)

30. 하나님의 놀라운 접착제 : 물속에서 달라붙는 한 편형동물의 경이로운 능력 (God's amazing glue)

31. 조개껍질과 나비를 모방한 나노제품 (Nanofabrication Imitates Shells, Butterflies)

32. 폭격수 딱정벌레를 모방한 새로운 분무기 (New Atomizer Mimics Bombardier Beetle)

33. 한 발 다가선 도마뱀붙이 모방 접착제  (A Step Closer to Gecko Adhesive)

34. 규조류를 이용한 고효율 태양전지 (Better Solar Cells with Diatoms)

35. 가시 랍스터(닭새우)의 자기이상 인식 기술을 모방하여 이동하는 로봇 (Robot Navigation Copies Spiny Lobsters)

36. 돌고래의 매끄러운 피부를 모방한 새로운 선체 기술 (New Hull Technology a Slick Design Copy)

37. 곤충을 따르라! : 생체모방공학의 새로운 연구들 (Follow the Insects)

38. 도마뱀붙이의 발바닥 오염을 제거하는 슈퍼소수성 인지질. (Scientists Discover New Clue to Geckos' Climbing Ability)

39. 새우 껍질은 새로운 생분해성 재료에 영감을 주고 있다. :생체모방공학의 또 하나의 사례 (Shrimp Shells Inspire New Biodegradable Material)

40. 생체모방공학을 통한 강렬한 희망 1 : 계속 발견되고 있는 생물들의 경이로운 능력들 (Living Surprises, Living Hopes)

41. 생체모방공학을 통한 강렬한 희망 2 : 계속 발견되고 있는 생물들의 경이로운 능력들 (Living Surprises, Living Hopes)

42. 차세대 리더는 식물과 동물이다! (Follow the Leader: Plants and Animals)

43. 단풍나무 씨앗을 모방한 소형 비행 로봇 (Maple to the Rescue)

44. 식충식물이 R&D 수상을 이끌다 : 생체모방공학의 새로운 기술들 (Pitcher Plant Inspires R&D Award)

45. 생물에서 발견되는 경이로운 기술들 : 나비 날개의 광흡수, 소금쟁이의 부양성, 생물학적 배터리 (From Wonders of Nature to Wonders of Technology)

46. 자연이 38억 년 동안 연구개발을 했는가? : 생체모방공학의 계속되는 성공 - 해바라기, 규조류, 식물 의약품... (Nature : 3.8 Billion Years of R&D)

47. 개, 올빼미, 딱정벌레를 모방하라 : 생체모방공학은 우리의 삶을 증진시킬 것이다. (Make Like a Dog, Owl, or Beetle : How Biomimetics Will Improve Our Lives)

48. 생체모방공학 소식으로 시작되는 한 해 (Happy New Biomimetics Year)

49. 계속되는 생체모방공학의 성공 : 반딧불이, 나무, 피부, DNA, 달팽이처럼 만들라. (Make Like a Firefly)

50. 큰부리새, 굴, 거미를 이용한 생체모방공학 (What Do a Toucan, an Oyster and a Spider Have in Common? Bio-Engineers’ Drool)

51. 생체모방공학의 여러 소식들 (Biomimetics Roundup)

52. 먹장어, 도마뱀붙이, 잠자리의 생체모방공학 (Of Hagfish, Geckos and Dragonflies)

53. 개구리 발바닥을 모방하라! : 더러운 곳과 물속에서도 사용할 수 있는 접착 테이프 (A Sticky Solution : God Invented It First)

54. 광합성의 양자 비밀이 밝혀졌다. (Quantum Secret of Photosynthesis Revealed)

55. 식물이 전기 신호를 보내고 있다는 충격적 증거! (Shocking Evidence of Electrical Signals in Plants)

56. 식물을 사랑해야 될 더 많은 이유들 (More Reasons to Love Plants)

57. 동물과 식물의 경이로운 기술들 : 거미, 물고기, 바다오리, 박쥐, 날쥐, 다년생 식물 (Animal and Plant Tricks)

58. 편평한 식물 잎에 숨어있는 놀라운 설계 (Flat leaves—a curly problem)

59. 해파리 : 바다에서 가장 효율적인 수영선수! (The Ocean’s Most Efficient Swimmer Is… A Jellyfish)

60. 나비의 날개 : 방수 옷에 영감을 불어넣다. (Butterfly Wings: Inspiration for Waterproof Clothing?)

61. 놀라운 능력의 동물들 : 코끼리, 돌고래, 물고기, 꿀벌, 거미, 무당벌레 (Amazing Animals)

62. 여우는 자기장을 감지할 수 있는가? (Do Foxes Have Magnetic Senses?)

63. 생물권 전역에서 공학적 설계가 발견되고 있다. : 생체모방공학의 계속되는 행진 (Engineering Designs Found Throughout the Biosphere)

64. 역공학이 밝혀낸 이상적 추진 방식. : 생물들의 유사한 공학적 구조는 우연(수렴진화)인가, 설계인가? (Reverse Engineering Reveals Ideal Propulsion Design)

65. 모든 발명에 영감을 주고 있는 생체모방공학 (Biomimetics Is All About Design Inspiration)

66. 고양이의 수염과 일각고래의 엄니는 감각기관. 그리고 바다뱀, 초파리, 캐나다두루미의 놀라운 특성들. (Cat Whiskers and Narwhal Tusks: Why Things Are)

67. 물 위에서 걸을 수 있도록 하는 설계 : 소금쟁이 다리에서 발견된 최적화된 기하학 (Designed to Walk on Water)

68. 경이로운 공학 기술이 수백만 년의 자연적 과정으로? : 생체 모방 공학자들의 논리적 오류 (Millions of Years of Evolution Equal Engineering?)

69. 딱따구리, 혈액응고, 분자모터를 모방한 생체모방공학 (Three More Ways to Benefit from Nature’s Designs)

70. 식물도 눈을 가지고 있다. (Even the Plants Have Eyes)

71. 과학자들도 놀라는 기능들이 우연히 생겨날 수 있을까? : 거미, 빗해파리, 개미, 새, 삼나무, 개구리, 문어, 상어.. (Wonderful Lives)

72. 진화론을 거부하는 규조류 : 정교한 구조와 다양한 아름다움을 가진 경이로운 생물. (Homage to Diatoms)

73. 동물들의 새로 발견된 놀라운 특성들. : 개구리, 거미, 가마우지, 게, 호랑나비, 박쥐의 경이로움 (New Amazing Animal Discoveries)

74. 생물들의 정교한 공학기술과 최적화. : 박쥐, 말벌, 물고기, 꿀벌, 개미, 얼룩말과 생체모방공학 (Life Shows Exquisite Engineering and Optimization)

75. 문어의 피부를 모방한 최첨단 위장용 소재의 개발. (Octopus Skin Inspires High-Tech Camouflage Fabric)

76. 위장의 천재 문어는 피부로 빛을 감지하고 있었다! : 로봇 공학자들은 문어의 팔은 모방하고 있다. (The Octopus: Invertebrate Designs)

77. 생체모방공학의 새로운 뉴스들. (What’s New in Biomimetics?)

78. 생물들의 놀라운 기술과 생체모방공학 : 이러한 기술들이 모두 우연히 생겨났을까? (Inspiring Life Tricks)

79. 생체모방공학 분야는 지속적으로 확장되고 있다 : 뼈, 힘줄, 곰팡이, 법랑질, 효모, 곤충, 홍합, 말벌, 파리매... (Weekend Biomimetics Showcase)

80. 뼈의 미세구조를 모방하여 개량된 균열에 강한 강철 (Improved Steel Copies Bone Microstructure)

81. 박쥐의 비행을 모방한 최첨단 비행 로봇의 개발 (Bats Inspire High-Tech New Flying Robots)

82. 도마뱀에서 발견되는 경이로운 특성들은 지적설계를 가리킨다. (Lizards that Leap Over Evolution)

83. 바다의 카멜레온인 갑오징어는 스텔스 기술도 갖고 있었다. (Smart and Stealthy Cuttlefish)

84. 전기뱀장어의 놀라운 능력은 진화를 거부한다. (Stunning and stealthy : The amazing electric eel)

85. 문어의 유전체는 사람의 것만큼 거대했다. (Octopus Genome as Large as Human Genome)

86. 까마귀와 앵무새가 똑똑한 이유가 밝혀졌다! : 새들은 2배 이상의 조밀한 뉴런의 뇌를 가지고 있다. (Neuron-Packed Bird Brains Point to Creation)

87. 음악가처럼 행동하는 새들은 진화론을 부정한다 : 때까치는 새로운 곡조를 만들어 노래할 수 있다. (Musical Bird Maestros Befuddle Evolution)

88. 걸어 다니는 대성당 : 거북 등의 경이로운 건축 구조 (Walking Cathedrals, Design in Nature)

89. 물고기의 지능은 원숭이만큼 높을까? (Fish as Smart as Apes?)

90. 최적 설계된 메뚜기와 게의 다리 (Optimized Engineering in Locust Legs)

91. 동물들은 생각했던 것보다 훨씬 현명할 수 있다. : 벌, 박쥐, 닭, 점균류에서 발견된 놀라운 지능과 행동 (Animals Can Be Smarter Than You Think)

92. 생물에 있는 복잡한 감지기와 '아마존 고' (Amazon Go, Creatures Depend on Sophisticated Sensors)

93. 쇠똥구리 : 초원을 보존하는 작은 일꾼 (Dung Beetles: Promoters of Prairie Preservation)

94. 벌새와 박쥐는 빠른 비행에 특화되어 있었다. (Fast Flight Specializations in Birds and Bats)

95. 생물에서 발견되는 초고도 복잡성의 기원은? : 나방, 초파리, 완보동물, 조류와 포유류의 경이로움 (Clever Critters)

96. 오징어는 날고 있었다! (Squid do fly!)

97. 개구리의 경이로운 혀와 침! (Super-Sticky Spit: How a Frog Gets a Meal)

98. 1초에 800번 날갯짓을 하는 모기의 비행은 설계를 가리킨다. (High Frequency Mosquito Flight Shows Design)

Randy Guliuzza
2017-06-06

미생물도 의사소통을 하고 있었다! 

(Microbes Talk More than People Do)


      의사소통(communication)은 생태계를 구성하는 생물들에게 기본 요소인 것처럼 보인다. 사람과 동물은 공통 언어를 공유하고 있지 않아도, 여러 면에서 서로 의사소통을 할 수 있다. 네덜란드 생태학 연구소(Netherlands Institute of Ecology, NIOO-KNAW)의 흥미로운 새로운 연구 결과에 따르면, 서로 다른 종류의 미생물들 사이에서도 의사소통이 이루어지고 있다는 것이다. 그들은 몇몇 박테리아와 곰팡이들이 상호 통신을 위한 전달 매개체로 테르펜(terpenes)으로 알려진(7/23/2016), 휘발성 유기화합물(volatile organic compounds, VOCs)을 사용하는 몇몇 시스템 요소들을 발견했다. NIOO(2017. 4. 13)는 이 놀랄만한 사실을 다음과 같은 제목으로 보도하고 있었다 : ”세계에서 가장 많이 사용되는 언어는 ... 테르펜”이다.

슈미트(Ruth Schmidt)와 그의 연구팀은 토양세균인 세라티아 플리무티카(Serratia plymuthica PRI-2C)가 곰팡이 푸사리움 쿨모룸(Fusarium culmorum)에 의해서 방출되는 휘발성 유기화합물에 노출되었을 때, 운동성이 활발해지면서, 자신의 테르펜인 소도리펜(sodorifen)을 만드는 반응을 보였다는 것이다.[1]

지적설계된 것처럼 보이는 생물계의 시스템들은 진화론을 부정한다.

토양미생물은 환경에서 휘발성 유기화합물 비율의 변화를 감지할 수 있는 것처럼 보인다. 그런 다음 적절하게 자체 조정을 한다. 이전의 연구들은 휘발성 유기화합물이 종간(inter-species) 미생물 통신을 위한 ‘신호 분자(infochemicals)’로 사용된다는 것을 확인했다. 연구팀은 미생물들의 관계에서 휘발성 유기화합물이 ”신호로 인식되는 방법”을 조사한 다음, 반응에 관여하는 조절 유전자들과 경로를 확인했다. 근권(rhizosphere, 식물 뿌리의 영향이 미치는 범위)에서 분리된 토양세균 S. plymuthica는 곰팡이 Fusarium culmorum에서 방출된 휘발성 유기화합물에 노출되거나, 또는 노출되지 않고 자란다. 곰팡이가 방출한 휘발성 유기화합물에 대한 박테리아 반응의 분자적 기초를 확인하기 위해서, 박테리아의 전사체(transcriptome)와 단백질군(proteome)이 각 상황 하에서 분석되었다.

정교한 생체분자 시퀀스와 센서를 사용하여, 그들은 토양세균 S. plymuthica가 화학주성, 운동성, 신호 전달, 에너지 대사, 세포 외피, 테르펜 소도리펜 등과 관계가 있는 여러 유전자와 단백질들을 차별적으로 발현한다는 사실을 발견했다. 소도리펜의 생성은 곰팡이 F. culmorum에 의해서 탐지되는 것으로 보이며, ”이러한 박테리아-곰팡이 대화에 관련되어 있었다.”

세계에서 가장 많이 사용되는 언어는... 테르펜이다. 미생물들은 냄새를 통해서, 서로 그리고 다른 세계와 통신한다.  - NIOO 보도자료

실험은 잘 설계되었으며, 연구팀은 결과를 정확하게 분리하기 위해서, 인상적인 기법을 사용했다. 따라서 그들은 ”곰팡이의 휘발성 유기화합물은 토양세균 S. plymuthica에서 차별적으로 발현되는 화합물들의 생산을 유도한다”고 결론지었다.


설명이 필요한 부분

그러나 그들은 정확한 결론에 도달했던 것일까? 곰팡이가 박테리아의 유전자를 통제하여 그 생성물을 조절할 수 없다는 점을 감안할 때, 곰팡이가 실제로 박테리아의 밖에서 어떤 것이 발현되도록 박테리아를 유도할 수 있는 것일까? 그들의 결론은 엄격한 기술을 사용했음에도 불구하고, 정확한 것이라고 말할 수 없는 것이다. 왜냐하면 완전하고 정확한 결론을 제시하기 위한, 식별되거나 설명되어야하는 주요 시스템 요소들에 대한 설명이 생략되었기 때문이다. 생물들의 기능이 지적설계된 것으로 분석될 수 없기 때문에, 그러한 생략은 진화론적 논문들에서는 흔히 볼 수 있는 일이다.

연구자들은 다음과 같이 설명될 필요가 있는 편재되어 있는 현상을 관측했다 : ”생물체들 간의 상호작용과 의사소통은 어떤 생태계를 이해하는데 있어서 중요하다. 다른 생물체들과의 의사소통에 있어서 정보화학물질(infochemicals)로 알려진 휘발성 유기화합물(VOCs)들이 핵심적 역할을 하고 있다는 것은 30년 이상 인정되어 왔다.” 두 개의 독립적인 별개의 생물체들이 어떻게 함께 작동될 수 있는 것일까? 한 생물체가 생산하는 화학물질이 어떻게 다른 생물체에게 '정보' 또는 '신호'로 인식되는 이유는 무엇인가? 상투적으로, 증거가 없는 추정 이야기인 ‘공진화(coevolution)'라는 용어가 이러한 지식의 간격을 메우기 위해서 삽입되고 있었다.


의사소통의 본질

그러나 두 개의 독립적인 개체들이 함께 작동되기 위해서는, 그들은 하나의 인터페이스 시스템(interface system)으로 연결되어 있어야만 한다. 몇몇 인터페이스(interface) 또는 브리징(bridging) 메커니즘은 모든 상호작용과 의사소통에 있어서 절대적으로 필요하다는 것이 최근 Creation Research Society Quarterly 지에서 보고됐었다.[2] 슈미트 등의 곰팡이와 박테리아의 상호 통신에 관한 보고에서, 연구자들은 그러한 요소에 대해서는 어떠한 것도 언급하고 있지 않았지만, 곰팡이와 박테리아 둘 다 3가지의 필수적인 인터페이스 요소들을 가지고 있는, 일종의 인터페이스임을 틀림없다.

. 자기와 비자기(self and non-self)를 구별할 수 있는 인식 메커니즘

. 정보 및 자원의 교환을 관리하는 프로토콜(protocol) 규칙 및 과정들.

. 두 개체가 상호 접근할 수 있는 조건에서의 공통 매체.

이들 세 가지의 요소들은 인터페이스의 기본 기능을 달성하는데 있어서 필요한, 최소한의 상호작용을 하는 부분들이다. 부품들 중 하나라도 결여되어 있다면, 인터페이스 시스템은 작동되지 못하고 중단될 것이다.

생물체의 자체 조절은 항상 자신의 선천적 시스템을 통해서 이루어진다. 그 결과는 변화된 상황(내부 또는 외부)의 탐지에 의한 자가-조정이다. 따라서 곰팡이 F. culmorum이 방출하는 휘발성 유기화합물에 노출되거나 노출되지 않았을 때의 토양세균 S. plymuthica의 조절은, S. plymuthica의 구별된 경계를 위반함에 의해서도 아니고, 직접 그 시스템을 처리함에 의해서도 아니다.

곰팡이 F. culmorum은 (S. plymuthica와 같이 사용하는 공통 매체인) 환경으로 방출되는 휘발성 유기화합물을 생산한다. 토양세균 S. plymuthica 내의 프로토콜은 이러한 휘발성 유기화합물을 자극으로 인식하고, 바깥 경계면에는 이들 휘발성 유기화합물에 대한 특별한 탐지기를 갖고 있다. 반면에 다른 프로토콜은 자신의 유전자 생성물의 발현을 자체 조정하는 방법을 지정해 놓고 있는 것이다. 토양세균 S. Plymuthica는 운동성이 활발해지고, 소도리펜이라는 자신의 테르펜을 생산한다. 이 물질은 곰팡이 F. culmorum에 의해 검출될 수 있도록 공통 매체 내로 방출된다. 이것은 필수적인 특별한 감지기에 의해서 증강되어, 하나의 자극으로 특화된다. 그리고 내부의 프로토콜에 의해서 자가-조정된다. 이것으로 ”박테리아-곰팡이 대화”가 가능하게 되는 것이다.


인터페이스가 진화할 수 있는가?

인터페이스는 죽음과 생존의 반복 과정을 통해서는 설명되기 어렵다. 한 생물체 내의 정보가 다른 생물체와의 관계에서 그 생물체가 얻기 원하는 결과를 예측하는 방식으로 기능하기 때문이다. 이러한 결과들은 다른 비자기(non-self) 시스템에 의해서, 특정 조건(즉, 특정 자극)을 감지한 후 시작되는, 자신들의 내부 과정들에 의한 특별하고 필요한 연속적인 최종 결과물이기 때문이다. 슈미트 등이 ”곰팡이의 휘발성 화합물이 ...의 생성을 유도한다”라고 결론을 내렸을 때, 어떤 노출로부터 하나의 반응으로 바로 건너뛰는, 잘못된 설명을 했던 것이다. 미생물들의 의사소통이 어떻게 일어날 수 있는지에 대한, 모든 중요한 시스템 요소들을 생략한 채 건너뛰고 있었던 것이다.


.Schmidt, R. et al. 2017. Fungal volatile compounds induce production of the secondary metabolite Sodorifen in Serratia plymuthica PRI-2C. Scientific Reports. 7(862): 1-14. DOI:10.1038/s41598-017-00893-3 ]

.Guliuzza, R. J. and F. Sherwin, 2016. Design Analysis Suggests That Our 'Immune” System Is Better Understood as a Microbe Interface System. Creation Research Society Quarterly. 53 (2):27-43.



슈미트(Schmidt) 등의 연구 결론은 지적설계에 기초했을 때 더 잘 설명될 수 있다. 사람이 설계한 기계에서, 기능적 인과관계는 100% 설계된 프로그램 내에서만 발생한다. 생물체들 사이에서 발견되는 요소들의 상호작용에 대한 진정한 원인을 식별하고자 할 때, 지적설계 방법론은 모든 시스템 요소들을 설명할 수 있다. 지적설계 방법론은 정확성을 혼란스럽게 하는 요소들을 생략하거나 얼버무리지 않는다. 그리고 환경적 압력에 의한 공진화와 같은 입증되지 않은 미스터리한 추정 이야기로, 생물학적 인과관계를 잘못 설명하는 오류를 방지할 수 있는 것이다.

 


*관련기사 : 놀라운 박테리아, 전자신호로 소통 (2017. 1. 15. Science Times)

'세균도 소통하며 집단행동 팀플레이 한다' (2010. 4. 13. 한겨레)

언어로 의사소통하는 미생물 (2012. 4. 12. 중부매일)

새에게도 '도와줘요', 식물은 소통의 '달인'  (2013. 7. 30. 한겨레)

식물도 말하고, 싸우고, 생각합니다 (2016. 8. 27. 조선일보)



번역 - 미디어위원회

링크 - http://crev.info/2017/05/microbes-talk-people/

출처 - CEH, 2017. 5. 20.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6619


참고 : 

1. 생명체의 본질로서 정보 통신 (Life as the Communication of Information)

2. 식물은 땅속의 ‘곰팡이 인터넷’을 사용하여 통신을 한다. (Plants Use Underground 'Fungal Internet' to Communicate)

3. 식물에서 인트라넷이 작동되고 있었다. : 식물 내의 정교한 통신 시스템은 진화론을 거부한다. (Plant Intranet Seen in Action)

4. 나무들은 아스피린으로 의사전달을 한다. (Trees Communicate With Aspirin)

5. 춤추기로 의사 전달을 하고 있는 벌들 (Dancing bees)

6. 세균과 식물들은 네트워크 기술을 알고 있었다. (Bacteria and Plants Know Network Tech)

7. 식물은 사회적 통신망으로 소통하고 있다. (Plants Have Social Networks)

8. 시베리아 어치 새는 복잡한 의사소통을 할 수 있다. (Jay Talking)

9. 소리로 의사소통을 하는 개미는 창조를 증거한다. ('Talking' Ants Are Evidence for Creation)

10. 도마뱀 언어 (Lizard Language)

11. 꽃들은 벌을 위한 ‘전기적 착륙유도등’을 켜고 있었다. (Flowers Create ‘Electric Landing Lights’ for Bees)

12. 식물이 전기 신호를 보내고 있다는 충격적 증거! (Shocking Evidence of Electrical Signals in Plants)

13. 초식성 개미와 소화관 내의 공생하는 미생물들 (Bacterial Gut Symbionts Are Tightly Linked with the Evolution of Herbivory in Ants).

14. 완두진딧물과 박테리아와의 공생 관계는 창조를 가리킨다. ('Simple and Elegant' Insect Design Showcases Creation)

15. 장내세균과 장의 협력 관계에서 새로운 사실의 발견. (Were Intestines Designed for Bacteria?)

16. 토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. (Iron-mining Fungus Displays Surprising Design)

17. 생명정보의 비밀

Frank Sherwin
2017-05-30

창조와 조류독감 

(Creation and the Bird Flu)


     우리는 유행성 감기(influenza) 또는 독감(flu)이라고 불리는 불쾌한 바이러스 질환에 익숙해 있다. 아담과 이브는 바이러스 균과 함께 창조되지 않았다. 그러한 병원균들은 타락(Fall)(창세기 3장)의 결과였다. 그때 이후 역사는 전 세계적으로 유행성 감기의 발생을 보여주었다. 1918년에 발생한 비극적인 유행성 감기로 65∼70만 명의 미국인을 포함해서, 전 세계적으로 2천만-1억 명(가장 일반적인 통계는 4천-5천만 명)의 사람들이 죽은 것으로 추산되고 있다.


1918년에 그 비극적 사건을 일으킨 바이러스 균주는 너무도 치명적이어서 오랫동안 의학적 신비로 여겨져 왔다. 과거에 많은 독감 바이러스의 아형(subtypes)들이 중국에서도 있었던 것으로 여겨진다. 그들의 전파는 주로 돼지, 오리 등과 같은 가축들로부터의 폭로에 기인한 것으로 보인다. 제한된 지역 내에서 가축들 간에 무작위적 혼합은 항원 대변이(antigenic shift, 항원성 변화의 일종)라고 불려지는 결과인, 파괴적이고 전파력이 강한 균주를 분명 만들었을 것이다. 간략히 기술하자면, 항원 대변이는 바이러스의 주요 항원 표면을 암호화하는 유전자들의 재조합(recombination), 또는 재배열(reassortment)에 의해서 발생한다. 돼지(돼지 독감 바이러스), 사람(사람 유행성 감기 바이러스), 조류(조류 독감 바이러스) 등을 포함하여, 그러한 항원 변이는 매우 전염력이 강한 바이러스 균주를 만들어 낸다. 그러나 이것이 일부 사람들에 의해 주장되고 있는 것처럼 진정한 수직적 진화인가? 아니다! 그 바이러스는 변이되고, 재조합된 유전자들을 가지고 있는, 하나의 독감 바이러스에 불과한 것이다.


현재, 보건 당국은 북미 대륙에 접근하고 있는 한 조류독감 바이러스에 긴장하고 있다. 적어도 1억5천만 마리의 가금류가 그 바이러스로 인해 죽거나, 확산 저지를 위해 도살처분 되어지고 있다. 이 유행하고 있는 조류독감 균주인 H5N1으로 인한 최초의 사람 감염은 1997년 홍콩에서 6명의 사람들이 사망함으로서 발생했다. 6월 6일까지, 이 바이러스는 10개 국가에서 적어도 225명의 사람들을 감염시켰다. 모든 경우들이 감염된 동물(예를 들면 조류)들과의 접촉을 통하여 전염되었다. 연구원들은 바이러스가 이제 사람들 사이에서도 고도로 감염력을 가지면서 전파되어질 것을 두려워하고 있다.


우리는 오늘날 유행할 가능성이 있는 조류독감에 대한 계시적 의미를 알아야만 할 것이다. 그러한 일이 다시 발생할 수 있을까? 창조과학자인 알란 길른(Alan Gillen)은 “파괴적인 형태는 아니지만, 어느 의미로는 그것은 이미 발생하고 있다“고 말한다. 1957-1958년에 '아시아 독감(Asian flu)'는 70,000 명의 미국인들을 죽였다. 1968-1969년에 '홍콩 독감(Hong Kong flu)'은 34,000 명을 죽였다. 그 해에, 인플루엔자 A형(H3N2)이라고 불렸던 새로운 아형은 약한 바이러스였다. 왜냐하면 아마도 헤마글루티닌 단백질(hemagglutinin protein, H3—the viral surface)만이 변화되어졌고, 뉴라미니다아제(neuraminidage, N2—a critical enzyme)는 같은 형태로 머물러 있었기 때문이었다. 그래서 사람들에게 그것에 대한 약간의 저항성이 남아있었기 때문이었다. 인플루엔자 A형(H3N2) 독감은 1968년 출현한 이후 지금까지 미국에서 400,000 명을 사망시켰고, 65세 이상의 노인들의 90%에서 발병하였다.


의학 기술은 지난 반세기 동안에 현저하게 발전했다. 길른에 의하면, 오늘날은 독감 발생에 대한 역학보고 시스템을 가지고 있고, 독감에 대항하는 백신 제조 방법을 알고 있으며, 1918년 대유행으로 많은 사람을 죽였던 세균성 감염을 치료할 항생제들을 가지고 있고, 몇몇 유용한 항바이러스성 의약품들 까지도 가지고 있다는 것이다. 한편, 창조과학자들은 전염병의 기원과 병원성 세균들의 기원에 관한 많은 조사들을 실시해야 할 것이다. 조류독감이 몇몇 사람들이 말하는 것처럼 악성 괴질이든지, 또는 주기적 대유행을 할 것인지 간에, 기록된 말씀처럼 아무 것도 염려하지 말자.(빌 4:6). 하나님이 우리들을 권고하시기(돌보시기) 때문이다.(벧전 5:7).


* Frank Sherwin is a zoologist and seminar speaker for ICR.


*참고 : 병원균과 같은 미생물들은 어떻게 살아남았습니까? 노아의 식구들이 각종 병원균에 감염되지 않았다면 이들은 홍수 시에 모두 사라졌어야 하는 것 아닙니까?
http://www.creation.or.kr/qna/view.asp?cate=B02&id=53&no=14



번역 - 미디어위원회

링크 - http://www.icr.org/article/2944/

출처 - ICR, BTG 214b, 2006. 10. 1.

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=3801


참고 :

1. 창조, 타락, 그리고 콜레라 (Creation, Corruption, and Cholera)

2. 회의론자들의 도전 : 사랑의 하나님은 왜 킬러 해파리를 창조하셨는가? (Skeptics challenge : a ‘God of love’ created a killer jellyfish?)

3. 창조와 저주 (Creation and the Curse)

4. 고기를 먹지 않는 사자 : 육식동물도 채식으로 살아갈 수 있음을 보여주는 한 사례 (The lion that wouldn't eat meat)

Daniel Criswell
2017-05-30

생명체의 암호: 작은 낱말, 큰 메시지 

(The Code of Life: Little Words, Big Message)


      우리들 대부분은 연설이나 대화에서 어려운 단어들을 사용하는 사람들의 뛰어난 지성에 감동을 받는다. 실제로 그 단어의 의미하는 바와, 그것들을 사용하는 법, 그리고 그것들의 철자를 알고 있는 사람들에게는 훨씬 더 인상적이다. 한편 어느 누구도 허클베리 핀(Huck Finn)이나 톰 소여(Tom Sawyer)가 사용한 ‘영어’ 단어와 발음에 대해서 비난하지 않는다. 그러나 어떠한 정치인이라도 ‘네’, ‘음’, ‘그리고’, 저’, ‘쯧쯧’...등과 같은 낱말들을 자주 사용하는 연설로는 유권자들의 마음을 사로잡지 못할 것이다. 물론, 연설자가 마크 트웨인(Mark Twain)처럼 탁월한 문장력을 지닌 사람이라면 예외일 수 있지만 말이다.


속어와 구어체적 표현을 사용함으로써, 트웨인은 단어의 선택이 어떤 인물에 대한 여러 단계의 정보를 전달할 수 있음을 보여주었다. 마찬가지로, 생명체의 암호(유전암호, genetic code)를 구성하고 있는 ‘단어(words)’들도 또한 여러 단계의 정보를 전달하고 있다. 유전암호의 ‘단어’들은 유전자(genes)라고 불리는 ‘문장(sentences)’을 형성한다. 그 유전자들은 다기능적(poly-functional)으로 어느 방향으로 그 유전자(문장)가 읽혀지는가, 혹은 그 유전자가 어디서 시작하고 멈추는가에 따라, 1개 이상의 단백질들을 생산해낼 수 있다 (Sanford 2005). 유전암호를 구성하고 있는 문자(letters)들은 정확한 단백질을 만들기 위한 암호화뿐만이 아니라, 단백질 서열과 구조 내의 오류를 최소화하고(Archetti 2004), 세포에 의해 생산된 단백질의 양을 조절하는 것을 도우며(Archetti 2004; Ikemura 1985; Chamary & Hurst 2005), 단백질이 정확한 기능적 형태로 접히는 것을(Quinn 1975; Kimchi-Sarfaty et al. 2006) 돕는 방식으로 조직화되어져 있다.


우리들 대부분은 텔레비전에서 보았거나, 적어도 고등학교 때 배운 생물 수업을 어느 정도 기억하고 있어서, 생명체를 형성하는 정보를 가지고 있는 요소가 (꽤 어렵고 장엄한 명칭 중의 하나인) 디옥시리보핵산(deoxyribonucleic acid)이라는 것을, 혹은 톰 소여를 더 좋아하는 우리 같은 사람들을 위한 용어로서 DNA 라는 것을 알고 있다. DNA는 생명체가 어떠한 형태로 될 것이며, 그것이 어떻게 기능하는 지를 결정하는 세 문자 형태로 된 단어들로 이루어진다. 유전암호 단어는 4 종류의 질소성 염기들인 아데닌(adenine), 시토신(cytosine), 구아닌(guanine), 티민(thymine)에 해당하는 A, C, G, T 문자들로 만들어진다. 각 암호 단어는 세 문자 형태로 이루어지기 때문에, 선택할 수 있는 네 문자로는, 유전암호는 단지 64(4³)개의 단어들을 가진다. 지구상 모든 형태의 생명체들을 만드는 데 필요한 정보는 이들 64개의 단어들로서 자세히 설명되는 것이다!


이 암호는 어떻게 작동되며, 이들 정보가 그것의 원인으로서 창조주의 존재를 어떻게 명백히 가리키고 있는지를 살펴보자. 유전암호에 대한 서론적 조사에서조차도 이것은 지적 근원으로부터 왔음에 틀림없음을 가리키는 여러 단계의 정보들이 드러난다. 유전암호가 생명체를 가능하게 만드는 기능적 단백질로 번역되는 방법은 건축가가 집의 청사진을 만들어서 집을 짓는 계약자에게 그것을 배달해주는 방법과 비슷하다. 세포의 경우 DNA가 청사진이며, 비슷한 핵산인 전령 RNA(messenger RNA)는 배달자이고, 단백질 합성을 위한 세포장치들은 계약자와 그의 일꾼들이다. DNA에서 4가지 염기인 A, C, G, T는 긴 사슬이나 중합체로 배열되어 있는데, 이것은 특정한 집을 짓기 위한 또는 단백질을 만들기 위한 청사진으로 제공된다. 이 문자들은 이중나선 분자를 형성하는 두 가닥의 사슬로 배열된다. 한 가닥은 암호화하는 정보를 가지고 있고, 상보적 가닥은 암호화하는 나선의 손상(돌연변이)을 교정하는 주형(template)으로 사용된다.

   DNA 암호서열        GAGTAGCAGTCCCCACCTTGACGC
   DNA 상보적서열     CTCATCGTCAGGGGTGGAACTGCG


이중나선 DNA 분자에서 G는 C와 A는 T와 짝을 이루고 있음에 주목하라. 이런 상보적 염기쌍은 DNA로부터 mRNA를 통한 세포장치로의 메시지 전사를 용이하게 한다. 세포 내에서 단백질 합성장치(계약자)에 메시지를 쓰기 위해서, 두 가닥의 DNA는 분리되고 효소(단백질)는 상보적 mRNA 가닥을 조성하는데, 그것은 T(티민) 자리에 다른 염기, U(우라실)을 가지므로 DNA와 다르다.

   DNA 암호서열     GAG-TAG-CAG-TCC-CCA-CCT-TGA-CGC
   mRNA               CUC-AUC-GUC-AGG-GGU-GGA-ACU-GCG


위의 예에서 서열(sequences)은 ‘코돈(codons)’이라고 불리는 mRNA에서의 세 문자 ‘단어’를 보여주기 위해서 세 문자씩 나누어서 표기하였다. 코돈은 유전암호를 세포 내의 단백질 합성장치로 전달하는 데에 책임이 있다. 단백질은 사슬처럼 서로 연결되어 있는 아미노산들로 이루어진다. 이 사슬은 단백질의 특정한 기능에 따라 실(filament)이나 구체(globule)형태로 접혀질 수 있다. 만약 이것이 하나의 실제 단백질이라면, 첫 번째 네 아미노산들은 네 개의 암호단어, 즉 코돈인 CUC, AUC, GUC, AGG에 기초해서 류신(leucine), 이소류신(isoleucine), 발린(valine), 아르기닌(arginine)일 것이다. 생명체에서 전형적으로 발견되는 아미노산들은 단지 20개이다. 그러나 64개의 코돈이 존재한다. 이것 때문에 각 아미노산은 1개 이상의 코돈들을 가진다. 류신과 아르기닌은 6개의 코돈을 가지는 반면, 대부분의 다른 아미노산들은 2개 내지 4개의 코돈을 가진다. 이러한 이유로 암호는 종종 ‘중복적’으로 나타나며, 각 코돈의 세 번째 문자는 대부분의 코돈에서 이 문자가 세포장치에 의해 선택된 아미노산에 영향을 미치지 않기 때문에 한때 ‘정크(junk, 쓰레기)’로 여겨졌었다. (그러나 이 세 번째 문자는 단백질의 접혀짐과 관련있음이 밝혀졌다. 아래 관련자료 링크 18번 참조).  


이것은 유전암호가 중복적임을 의미하는가? 혹은 이러한 코돈 내에 추가적인 정보가 있다는 것을 의미하는가? 서로 서로 비슷한 코돈들은 비슷한 화학적 특성을 가진 아미노산들에 대응한다. 사실상 코돈으로 사용되는 대부분은 돌연변이가 일어났을 때, 같은 아미노산이나 비슷한 화학적 특성을 가진 아미노산을 계속 암호화하는 것들이다 (Woese 1965; Willie & Majewski 2004). 6개의 다른 코돈인 CUC, CUA, CUU, CUG, UUA, UUG를 가지고 있는 류신은 어떻게 염기치환(base substitutions)이 한 단백질 내의 아미노산에 영향을 미치지 않을 수도 있는가에 대한 좋은 예를 제공한다.


류신을 만드는 6개의 코돈 중에서 시토신(C)으로 시작하는 네 개의 코돈 중, 세 번째 문자의 mRNA 변화로 인한 DNA 서열 내의 돌연변이는 아미노산 서열을 바꾸지 못할 것이다. 예를 들면, 위의 CUC-AUC-GUC-AGG 서열에서, 코돈 CUC를 CUA로 바꾸는 돌연변이는 아미노산 서열의 처음에 여전히 류신을 둘 것이다. 이런 종류의 돌연변이는 단백질 서열에서 어떠한 변화도 유발시키지 않는 동의적(synonymous) 혹은 중립적 돌연변이(neutral mutation)로 불려진다. 두 번째 코돈 내의 첫 번째 염기가 AUC에서 CUC로 바뀌었다면, 더 재미있는 시나리오가 될 것이다. 류신은 이 서열 내의 두 번째 위치에서 이소류신으로 치환될 것이다. 하지만, 이소류신, 류신, 발린은 모두 매우 비슷한 화학적 특성들을 가지고 있어서, 이들 아미노산들의 치환은 단백질의 구조와 기능에 있어서 매우 작은 변화만을 일으킬 것이다.


대조해서, 예로 들은 세 가지와는 꽤 다른 화학적 특성을 가진 아미노산인 아르기닌도 또한 꽤 다른 일련의 코돈을 가지고 있다. 대부분의 경우에 있어서, 아르기닌 코돈을 다른 세 아미노산들 중의 하나에 해당되는 코돈으로 바꾸기 위해서는 많은 돌연변이가 일어나야만 할 것이다. 따라서 유전암호는 합성된 단백질 내의 실수(돌연변이)의 영향을 최소화하고, 생물체 내의 무작위적인 변화의 발생을 감소시키도록 배열되어 있는 것이다.


또한 암호는 단백질의 생산 양과 속도를 결정하는 정보를 가지고 있다. 하나의 단백질을 조합하기 위해서, mRNA 상의 코돈은 다른 핵산, 즉 전령 RNA(tRNA)에 의해서 ‘읽혀진다.’ 그런데 그것은 교대로 새로 형성되는 단백질 내의 특정한 아미노산을 정확하게 정렬시킨다. CUC 코돈의 경우, tRNA가 류신을 아미노산 서열에 붙인다. 각각의 tRNA는 상보적 안티코돈(anti-codon; 대응유전자부호, 이 경우엔 GAG)을 가진 mRNA와 결합한다. 만약 합성되고 있는 단백질이 여러 개의 류신 아미노산을 가지고 있다면, mRNA 코돈이 CUC이고 GAG 안티코돈을 가진 커다란 tRNA 집단이 있을 때 합성은 더 빨리 진행될 것이다. 만약 류신의 경우 CUC 코돈이 많고, GAG 안티코돈을 가진 tRNA가 적다면, 단백질 합성 속도는 훨씬 느려질 것이다. 이러한 선호(preference)는 ‘코돈사용빈도 편향(codon usage bias)’이라고 불려진다. 세포에 의해 많은 양으로 생산되는 단백질들은 이용 가능한 가장 흔한 tRNA 안티코돈에 대응하는 mRNA 코돈을 가지고 있다 (Ikemura 1985). 세포 내에서 농도가 낮은 단백질들은 이용 가능한 가장 흔한 tRNA 종류들에 대한 코돈 편향을 이용하지 않는다. 따라서 결과적으로 느린 속도로 합성되는 것이다 (Archetti 2004; Ikemura 1985). 코돈사용빈도 편향은 세포 내에서 생산되는 특정한 단백질 양의 조절을 돕는다. mRNA 코돈은 바뀌지만 아미노산 서열은 바뀌어지지 않는, DNA 내의 동의적 돌연변이는 단백질이 생산되는 속도를 바꿔서, 결과적으로 세포의 기능을 바꿈으로써 잠정적으로 세포 내의 특정한 단백질 양의 변화를 야기할 수 있는 것이다.


비록 많은 코돈들 내의 세 번째 염기가 아미노산 서열을 결정짓는데 중요하지 않을 지라도, 이 위치는 mRNA의 구조에 영향을 미치는 정보를 가지고 있다 (Shabalina, Ogurtsov & Spiridonov 2006). 류신 코돈인 CUA, CUU, CUC, CUG 내의 세 번째 문자는 같은 장소에 있지만, 이 코돈의 각각은 다른 이차적 구조를 생산할 수도 있다. mRNA의 이차구조는 물질대사가 일어나거나 분해되기 전에 세포 내에서 mRNA가 얼마나 오랫동안 지속될 것인가를 결정하는 것을 돕는다. 세포가 mRNA로부터 만들 수 있는 단백질의 양은 mRNA가 세포 내에서 얼마나 오랫동안 살아남는가에 직접적으로 관련이 있다. 동의적 돌연변이들은 mRNA의 이차구조와 붕괴속도에 영향을 미치고, 차례로 특정한 한 단백질이 세포에서 생산되는 양에 영향을 미치고 있었다 (Duan and Antezana 2003). 비록 단백질 서열이 영향을 받지 않더라도, ‘동의적’ 돌연변이(예, CUA, CUU)를 통한 mRNA의 이차구조를 바꿈으로써 세포 내의 단백질의 양을 바꾸는 것은 인간의 질병과 관련이 있다 (Duan et al. 2003; Capon et al. 2004). 이러한 질환은 코돈 내의 ‘중복적인’ 세 번째 문자의 서열 완전성(sequence integrity)을 유지하는 것이 매우 중요하다는 것과, 그것의 변화가 어떻게 정상 세포의 기능에 영향을 미치는 가를 강조하여주고 있다.


현재의 자료들은 유전암호 내의 모든 염기들이 세포 내에서 적당한 양으로 정확한 단백질을 생산하는데 있어서 중요하다는 것을 보여주며, 이것들은 DNA 암호 내에 함유되어 있는 정보의 예들 중에서 단지 몇 가지일 뿐이다. 유전암호로부터 모든 정보들이 해독되어질 때, ‘동의적,’ ‘중립적’ 그리고 ‘중복적’과 같은 용어는 진부해질 것이다. 문어체 속에서 트웨인의 위트와 유머가 지성의 증거인 것과 마찬가지로, 유전암호의 단어들은 지적 창조자(Intelligent Author)의 증거이고, 이 생명체의 창조자는 작은 세 문자 단어를 사용해서 수많은 정보들을 가진 유전암호들을 채워 넣으셨던 것이다!



Endnote

Quinn, a creationist, proposed a model of how a synonymous base substitution in mRNA (one that does not change the protein sequence), could alter the protein structure and consequently its function. Thirty-one years later, Kimchi-Sarfaty provided evidence of this actually occurring in a cell.


References

1. Archetti, M. 2004. Selection on codon usage for error minimization at the protein level. J Mol Evol 59 (3):400-15.
2. Capon, F. et al. 2004. A synonymous SNP of the corneodesmosin gene leads to increased mRNA stability and demonstrates association with psoriasis across diverse ethnic groups. Hum Mol Genet 13 (20):2361-8.
3. Chamary, J. V., and L. D. Hurst. 2005. Evidence for selection on synonymous mutations affecting stability of mRNA secondary structure in mammals. Genome Biol 6 (9):R75.
4. Duan, J., and M. A. Antezana. 2003. Mammalian mutation pressure, synonymous codon choice, and mRNA degradation. J Mol Evol 57 (6):694-701.
5. Duan, J. et al. 2003. Synonymous mutations in the human dopamine receptor D2 (DRD2) affect mRNA stability and synthesis of the receptor. Hum Mol Genet 12 (3):205-16.
6. Ikemura, T. 1985. Codon usage and tRNA content in unicellular and multicellular organisms. Mol Biol Evol 2 (1):13-34.
7. Kimchi-Sarfaty, C. et al. 2006. A 'silent' polymorphism in the MDR1 gene changes substrate specificity. Science Express, December 21, 2006.
8. Quinn, L. Y. 1975. Evidence for the existence of an intelligible genetic code. Creation Research Society Quarterly 11:188-198.
9. Sanford, J. C. 2005. Genetic Entropy and the Mystery of the Genome. First ed. Lima, NY: Ivan Press.
10. Shabalina, S. A. et al. 2006. A periodic pattern of mRNA secondary structure created by the genetic code. Nucleic Acids Res 34 (8):2428-37.
11. Willie, E., and J. Majewski. 2004. Evidence for codon bias selection at the pre-mRNA level in eukaryotes. Trends Genet 20 (11):534-8.
12. Woese, C. R. 1965. On the evolution of the genetic code. Proc Natl Acad Sci U S A 54 (6):1546-52.

*Dr. Daniel Criswell has a Ph.D. in molecular biology and is a biology professor at the ICR Graduate School.

 


번역 - 창조과학회 대구지부

링크 - http://www.icr.org/article/3187/

출처 - ICR, Impact No. 405, 2007

구분 - 3

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=3862


참고 :

1. 경탄스런 극소형의 설계 : DNA에 집적되어 있는 정보의 양 (Dazzling design in miniature)

2. 비암호화된 DNA는 상상했던 것보다 훨씬 더 복잡했다 (Non-Coding DNA Has Far More Complexity Than Was Imagined)

3. DNA 복구 효소에서 발견된 극도의 정밀성 (Utmost Precision Found in DNA Repair Enzyme)

4. DNA는 인간창조의 설계도이다

5. ICR 에서의 지노믹스 (Genomics at ICR)

6. 창조와 조류독감 (Creation and the Bird Flu)

7. 로봇 올챙이는 지적설계를 가리킨다. (Robot Tadpole Sex Sheds Light on Intelligent Design)

8. 창조의 양 극단 (Extremes of Creation)

9. 설계자가 없는 설계 (Design without a designer)

10. Yeast DNA에서 언어 구조의 존재

11. 아무것도 아닌 것들 : 미세세계에서 보여지는 놀라운 창조의 증거들 (The things that are not)

12. 컴퓨터가 보여주는 진화론의 정보 문제 (Creation’s amazing computer)

13. 당신의 내부 모터들은 나노 공학으로 작동된다. (Your Internal Motors Can Run Nanotech)

14. 가장 작은 세포도 예상했던 것보다 훨씬 복잡하다. : 마이코플라즈마는 387 개의 단백질이 필수적이었다. (Minimal Cell More Complex Than Expected)

15. 유전자의 이중 암호는 고도의 지적설계를 가리킨다. (Dual-Gene Code Discovery Highlights Designed Biocomplexity)

16. DNA에서 제2의 암호가 발견되었다! 더욱 복잡한 DNA의 이중 언어 구조는 진화론을 폐기시킨다. (Two Genetic Codes Is Better Than One)

17. 듀온 : DNA의 이중 암호는 진화론을 거부한다. (Duons: Parallel Gene Code Defies Evolution)

18. 유전자의 이중 암호는 진화론을 완전히 거부한다. : 중복 코돈의 3번째 염기는 단백질의 접힘과 관련되어 있었다. (Dual-Gene Codes Defy Evolution...Again)

Frank Sherwin
2017-04-26

동물성 플랑크톤에서 발견된 다연발의 작살! 

: 하등하다는 원생동물에서 고도로 복잡한 기관의 발견 

(Lowly Plankton Packs High-Caliber Heat)


      플랑크톤(plankton)은 바다 조수와 해류를 따라 표류하며, 바다 먹이사슬의 기초를 형성하고 있는 미세한 생물들에 대한 일반적인 이름이다. 식물성 플랑크톤(phytoplankton)은 광합성을 수행하며, 주로 규조류(diatoms)로 이루어져 있다. 동물성 플랑크톤(zooplankton)은 규조류를 먹는 원생동물(protozoa)을 포함하는데, 수염고래(baleen whales, 이빨이 없는 종)는 두 종류의 플랑크톤들을 모두 먹이로 먹는다.


와편모충류(dinoflagellates)라 불리는 한 특별한 그룹의 플랑크톤은 두 개의 편모(flagella)를 갖고 있는 복잡한 해양 원생동물(marine protozoa)이다. 이들 생물은 일종의 미세한 꼬리인 편모를 사용하여 수영을 할 수 있다. 최근에, 이들 와편모충류에서 개틀링 총(Gatling gun, 세계 최초의 다중 총신 기관총)과 같이 작동되는 놀라운 사냥 메커니즘이 발견되었다.[1] 캐나다 브리티시 컬럼비아 대학의 생물학자들은 네마토디니움(Nematodinium) 종에서 이 작살-발사 캡슐(projectile-firing capsules, extrusomes, 발사체)을 발견했다.(사진과 동영상은 아래 관련기사 참조)


진화론적 과학자들은 '하등한' 플랑크톤에서 그러한 정교하고 복잡한 구조가 발견되리라고는 전혀 예상하지 못했었다. 어쨌든 이들은 단세포 미생물이다. 애리조나 대학의 그레고리 가벨리스(Gregory Gavelis)는 다음과 같이 말했다. ”사람들은 이들 와편모충류가 그들의  먹이를 어떻게 공격하는지 그 방법을 이해하지 못했었다. 왜냐하면 그들의 발사 메커니즘은 전혀 예상하지 못했던 복잡한 방법이었기 때문이었다.”[1]

예상하지 못했던 복잡성에도 불구하고, 그 기사는 연구팀의 발견에 대해 진화론적 왜곡을 가하고 있었다. ”연구자들은 이러한 발사체의 진화론적 기원에 대한 새로운 증거를 발견했다”[1]


그러나 사실은 그 반대이다. 그들은 이러한 독특한 형태의 발사 메커니즘이 독침을 쏘는 해파리(jellyfish, cnidarians)에서 발견되는, 자포(nematocysts)라 불리는 놀라운 세포기관과 흡사할 것이라고 예측했었다. 대신 그들이 발견한 것은 ”수렴진화(convergent evolution)의 매우 흥미로운 예”였다. 그러나 수렴진화는 과학적 설명이 아니다.[2] 그것은 진화론적으로 관련이 없는(친척이 아닌) 물고기(어류), 고래 및 돌고래(포유류), 멸종된 수생 파충류에서 발견되는 지느러미(fin)와 지느러미발(flipper)의 유사한 모습을 설명하기 위한(동일한 진화가 여러 번 일어났다는), 구조 장치에 불과하다. 또한 연구자들은 자포동물(cnidarians)의 자포는 와편모충류 발사체(extrusome)의 어떠한 유전자도 공유하지 않고 있다는 것을 발견했다. 이 발견은 진화론적 예측과 모순된다. 그러나 그들은 간단하게 ”매우 흥미롭다”고 말하며 넘어가고 있었다.[4]


창조과학자들은 이들 작살과 같은 발사체는 정교하며, 완전히 기능을 하는 메커니즘으로, 어떠한 진화적 징후 없이 완벽하게 기능한다는 것을 알고 있다. 이 매혹적인 사격 구조는 아담의 타락 전과 후 모두에서 먹이(detritus, 생물의 잔해나 배설물)를 얻는 방법으로 설계되었을 것이다. 가장 작고, ”가장 하등하다는” 생물조차도 놀라운 설계를 보여주고 있는 것이다.



References
1. Tiny plankton wields biological 'gatling gun' in microbial Wild West. ScienceDaily. Posted on sciencedaily.com April 3, 2017, accessed April 8, 2017.
2. Tomkins, J. P. Convergent Evolution or Design-Based Adaptation? Creation Science Update. Posted on ICR.org July 7, 2016, accessed April 11, 2017.

*Mr. Sherwin is Research Associate, Senior Lecturer, and Science Writer at the Institute for Creation Research.



*관련 기사 : 바다미생물 플랑크톤, 작살 쏘아 먹이 사냥 –동영상 (2017. 4. 4. 한겨레)

Lowly Plankton Have Evolved Sophisticated Harpoon Guns (2017. 3. 31. ABC News, 동영상)

Tiny plankton wields biological ‘Gatling gun’ in microbial Wild West

'Gatling Gun' Plankton Reveals Violent Microbial World (National Geographic, 2017. 4. 9)



번역 - 미디어위원회

링크 - http://www.icr.org/article/9970 

출처 - ICR News, 2017. 4. 20.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6593


참고 : 

1. 토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. (Iron-mining Fungus Displays Surprising Design)

2. 박테리아의 놀라운 빛 감지 능력 : 렌즈와 같은 세포 (The Crawling Eye: Cells as Lenses)

3. 세포가 저절로 만들어졌다고?

4. 세포의 미토콘드리아 세망은 도시 전력망을 닮았다. (Cell Feature Resembles Power Grid)

5. 세균의 대사는 컴퓨터 회로판과 같이 작동된다. (Bacteria Metabolisms Are Like Computer Circuit Boards)

6. 바이러스는 바다를 좋게 만들 수 있다. (Viruses May Do the Ocean Good)

7. 새로운 분자 모터 클러치가 발견되었다. (Scientists Discover New Molecular Motor 'Clutch')

8. 분별없이 박테리아를 미워하지 말라! (Don’t Hate Bacteria Irrationally)

9. 나노기술과 창조주

10. 효소는 진화할 수 없었음을 새로운 연구는 보여주었다. (New Study Shows Enzymes Couldn't Evolve)

11. 박테리아가 노화에 저항하는 독창적인 방법 (The Ingenious Way That Bacteria Resist Aging)

12. 단순한(?) 아메바가 박테리아를 사육하고 있었다. ('Simple' Amoebas Can Farm Bacteria)

13. 점균류의 네트워크는 철도 시스템을 능가하고 있었다. (Slime Networks Are Better Organized than Railway Systems)

14. 단순한 생물체 같은 것은 없다. (There’s No Such Thing as a ‘Simple’ Organism)

15. 세포의 분자 모터들은 함께 협력해서 작동한다. (Cell Motors Play Together)

16. 자기희생 세포들은 자신을 내어주신 설계자를 증거한다. (Self-sacrificing Cells Demonstrate a Selfless Designer)

17. 바이러스도 분자 모터들을 가지고 있었다. (Virus Motors Impossible for Evolution)

18. 자연이 38억 년 동안 연구개발을 했는가? : 생체모방공학의 계속되는 성공 - 해바라기, 규조류, 식물 의약품... (Nature : 3.8 Billion Years of R&D)

19. 규조류를 이용한 고효율 태양전지 (Better Solar Cells with Diatoms)

20. 스트레소좀 : 박테리아의 정교한 대처 메커니즘 (Stressosomes: Bacteria's Ingenious Coping Mechanism)

21. 균류에 있는 가장 빠른 분사기 (Fastest Squirt Gun in the Fungi)

22. 놀라운 세포의 비결 : 등고선 지도 네비게이션 (Amazing Cell Tricks: Contour Map Navigation) 

23. 박테리아 편모의 모터는 단백질 클러치를 가지고 있었다. (Bacterial Flagellar Motor Has a Protein Clutch) 

24. 작동 중인 분자기계 리보솜을 보라. (Watch a Ribosome in Action)

25. 세균의 편모 : 고도로 복잡한 초미세 구조가 우연히? (Evolution of the Flagellum : And the Climbing of ‘Mt. Improbable’)

26. 세포들은 그들의 신체 위치를 결정하는 데에 우편번호를 사용한다. (Cells Use Zip Codes to Determine Their Body Location)

27. 이 세균은 탱크처럼 이동한다. (This Bacterium Moves Like a Tank)

28. 포자 내부에는 나노 기술이 들어있다. (What's Inside a Spore? Nanotechnology)

29. 아무것도 아닌 것들 : 미세세계에서 보여지는 놀라운 창조의 증거들 (The things that are not)

30. 세상에서 가장 작은 나침반 : 보잘 것 없는 박테리아도 방향을 감지할 수 있었다. (The world’s smallest compasses)

31. 생물들은 우리가 알고 있는 것보다 훨씬 더 현명하다. : 아메바, 두꺼비, 곤충들이 보여주는 경이로운 능력들. (Life Is Smarter Than We Know)

32. 동전의 앞면은 진화론의 승리, 뒷면은 창조론의 패배? : 20억 년 이상 동일한 황세균의 발견. (Heads, Evolution Wins—Tails, Creation Loses?)

33. 20억 년(?) 동안 진화하지 않은 황세균. : 가장 오래된 '살아있는 화석'의 발견에도 진화론은 유지된다. (Two Billion Years and No Evolution)

Jeffrey P. Tomkins
2016-07-15

생체시계의 초고도 복잡성은 창조를 가리킨다. 

(Circadian Clocks, Genes, and Rhythm)


      생물체는 일주기리듬(circadian rhythm, 생체주기)이라 불리는, 24시간 낮-밤 주기의 시간 흐름을 따라가는 생물공학적 능력 없이는 존재할 수 없다. 컴퓨터나 마이크로 컨트롤러와 같은 정교한 전자장비는 중앙시계(central clock) 또는 진동자(oscillator)가 있다. 일주기리듬이라는 중요한 설계적 특성은 복잡한 시스템이 다른 시스템의 구성요소들과 함께 환경과 상호작용을 하면서 스케줄에 맞추어 작동되도록 내장되어 있음에 틀림없다.   


식물과 동물에서 일주기성 시계(생체 시계)는 사람이 만든 시스템보다 훨씬 더 발전된 것이다. 이 살아있는 시계는 생물체 내의 다양한 종류의 세포들과 조직들의 유전, 대사, 생리, 성장, 행동의 여러 측면들을 조절한다.[1, 2] 사실, 동물은 뇌에 있는 중심적 생체시계뿐만 아니라, 다른 조직과 장기들에 많은 국소적 시계들을 가지고 있다. 이 국소적 시계들은 세포, 조직, 또는 그것이 위치한 장기에서, 시간적 생리 및 공간적 생리와 조직화를 조절한다. 또한 각 시스템들은 뇌에 있는 중앙시계에 완벽하게 맞춰지고 있다. 아직 완전히 이해되지 않는 현상이지만, 복잡한 세포적 통신 네트워크(cellular communication network)가 조직과 신체 부분들을 시간-기반 전후관계로 연결시키고 있음이 분명하다.  


식물과 대형동물의 생물학적 네트워크는 너무도 복잡하기 때문에, 그러한 시스템은 초파리 같은 ‘간단한’ 생물에서 많이 연구되고 있다. CLOCK, CYCLE, PERIOD, TIMELESS와 같은 이름들이 주어진, 생체리듬을 조절하는 다수의 핵심 유전자들이 세포성 시스템 진동(cellular system oscillation)에 있어서 중요한 역할을 하고 있음이 밝혀졌다.[1, 2] 이 유전자들은 유전체에서 마스터 스위치로서 역할을 하며, 단계적으로 다른 유전자들의 스위치를 켜고, 고도의 협력 방식으로 작동되는, 전사인자(transcription factors)라 불리는 단백질들을 생산하고 있다. 사실, 이 유전자들의 일부는 빛에 반응하는 단백질들을 만드는데, 외부 빛의 강도와 빛의 유형(예로 청색광)에 따라 세포 내에서 그들의 기능이 조절된다. 아마도 가장 놀라운 사실은 이러한 '국소적 시계' 유전자들의 특수한 기능들은 세포가 위치하는 조직의 유형에 의존하여 달라진다는 것이다. 그러나 생체의 국소적 시스템도 여전히 생물체의 중앙시계와 전체적으로 동조(협력)되어 유지된다는 것이다.


같은 조직 내에서 뿐만 아니라, 연결된 조직들을 가로지르며, 상호 통신하며, 조절되는, 수많은 생체시계들에서 일어나는 이러한 경이로운 수준의 동력학적 복잡성을 어떠한 전기적 장치도 보여줄 수 없다.

사람이 이러한 수준의 상호 연결성과 복잡성을 이해하고 밝혀낸다는 것은 근본적으로 불가능해 보인다. 그리고 그러한 극도의 복잡성이 돌연변이라는 무작위적인 과정에 의해서 우연히 어쩌다가 생겨났을 것이라고 말하는 것은 완전히 비과학적인 주장이다. 이와 같은 상호 연결되어 있고, 상호 의존적인 시스템은 ‘한 요소도 제거 불가능한 복잡성(irreducible complexity, 환원 불가능한 복잡성)의 또 하나의 훌륭한 예가 되고 있는 것이다. 잘 알고 있듯이, ‘한 요소도 제거 불가능한 복잡성’은 모든 구성 요소들이 동시에 모두 있어야만 작동되는 시스템이다.


이러한 극도로 복잡한 시스템이 무작위적인 돌연변이와 자연선택에 의해서 구성 요소들이 하나씩 하나씩 우연히 생겨났고, 천천히 진화되어 생겨났다는 주장은 완전히 불합리한, 매우 우스꽝스러운 주장인 것이다. 초월적 지혜의 공학자가 극도로 복잡하고 조율된 시스템을 동시에 장착시키고, 작동시켰다는 주장이 훨씬 더 합리적으로 보인다. 그 분은 많은 종류의 식물들과 동물들에 이러한 극도로 복잡하고 정교한 시스템들을 넣어 놓으셨다. 우리가 생물들의 유전학을 더 많이 이해하면 할수록, 창조주에게 더 많은 감탄과 영광을 올려드릴 수밖에 없게 되는 것이다.



References

1.Ito, C. and K. Tomioka. 2016. Heterogeneity of the Peripheral Circadian Systems in Drosophila melanogaster: A Review. Frontiers in Physiology. 7 (8).
2.Tataroglu, O. and P. Emery. 2015. The molecular ticks of the Drosophila circadian clock. Current Opinion in Insect Science. 7: 51–57.

* Dr. Tomkins is Director of Life Sciences at the Institute for Creation Research and received his Ph.D. in genetics from Clemson University.



번역 - 미디어위원회

링크 - http://www.icr.org/article/9399

출처 -

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6416

참고 : 5391|5356|4712|1099|5604|6114|5654|5046|5746|5735|4034|5960|6199|6402|6391|6326|6289|6308|6302|6207|6161|6163|6182|6069|6034|6023|6001|5997|5976|5975|5962|5959|5934|5932|5926|5920|5438|5902|5899|5896|5894|5891|5888|5856|5850|5845|5839|5814|5810|5773|5759|5752|5767|5751|5694|5689|5673|5671|5608|5600|5598|5596|5560|5520|5513|5488|5444|5439|5382|5360|5359|5355|5351|5342|5335|5327|5317|5296|5287|5258|5224|5174|5128|5126|5120|5104|5103|5087|5072|5071|5022

생명체의 본질로서 정보 통신 

(Life as the Communication of Information)


      생명체의 본질은 무엇일까? 복잡한 유기물질들인가? 전달되고 있는 정보인가?


생명체는 모든 수준에서 정보를 송신하고 수신한다. 세포 기관들은 DNA 도서관에 정보를 보내고 정보를 받는다. 세포 집락들은 서로 분자 신호들을 전송하고 수신한다. 정자는 난자와 통신한다. 조직은 기관과 통신하고, 기관은 몸과 뇌와 통신한다. 생물들은 그들의 다중 감각을 통해 정보들을 전달하고 수신한다. 새들의 지저귐, 늑대의 울부짖음, 엘크의 우는 소리 등이 그것이다. 생태계는 통신하고 있다. 마지막으로, 지구에서 통신의 최고 대가(master)는 인류이다. 사람은 수 초만에 전 세계를 가로 질러 정보를 전달하고 수집한다. 심지어 지구 밖의 우주선과도 정보를 전달하고 받을 수 있다. 살아있는 생물들에서 일어나고 있는 통신에 관한 뉴스들을 살펴보자.


뉴런(Neurons) : 통신 시스템에서 통신망(network)은 기본이다. 신경 통신망은 일 주기성 시계에 의해 질서적으로 작동되기 위해서 동시화되어 있다. UC 산타 바바라(UC Santa Barbara, 2016. 4. 11)의 보도 자료는 그것을 설명하고 있었다. '정보 이론으로부터 단서를 얻다'라는 글에서 연구자들은 사람 생체시계를 실행하는 뇌의 부분에 전송되는 정보를 측정했다. 린다(Linda Petzold) 교수는 그것이 어떻게 통신되는지를 알고 싶어 했다. ”세포들이 어떤 특정 작업을 수행할 때 어떻게 통신되는 지를 이해함으로써, 약 20,000개의 뉴런에 작은 세포기관들이 수면, 배고픔, 체온조절, 호르몬 분비, 유전자 조절 등과 같은 기본 기능들을 조절하며 24시간 몸 전체를 유지 관리하는 방법에 대한 통찰력을 얻을 수 있을 것이라고, 그녀는 설명했다.”


나무 : Science Daily(2016. 4. 12) 지는 나무가 씨앗을 퍼트리기 위해서, 동물을 유혹하는 '과일 향기(fruit aroma)'의 역할에 대해서 보도했다.

”우리의 연구는 잘 익은 과일의 특징인 쾌적한 향기가 식물과 씨앗을 퍼트리는 영장류 사이에 통신을 매개하는 중요한 생태학적 기능을 가질 수도 있음을 최초로 입증했다.” 게재된 논문의 선임저자인 오머 네보(Omer Nevo)는 말했다. ”영장류는 쉽고 확실하게 잘 익은 과일을 식별할 수 있고, 대신에 식물은 영장류를 유혹하는 향기를 발산하여 씨앗의 분산을 촉진할 수 있다.”


개미 : 개미(ants)들이 긴 산책로를 지나가면서 그들의 더듬이(antennae)를 서로 접촉하는 이유는 무엇일까? 그들은 '양방향 통신 시스템(two-way communication system)‘을 사용하고 있다고, Science Daily(2016. 3. 30) 지는 말한다. 멜버른 대학의 한 연구원은 놀라고 있었다. ”개미의 더듬이는 주요한 감각기관이지만, 또한 정보를 전송하는데 사용될 수 있다는 것을 지금까지 결코 알지 못했다.” 더듬이는 단지 수신기만이 아니었다. 즉, 그것은 송신기로도 작동되는 것이었다. ”다른 모든 사람들처럼, 우리도 더듬이는 단지 수용기(receptors)라고 생각했었다. 하지만, 자연은 우리를 계속 놀라게 만들고 있었다.”


박쥐 : 박쥐(bats)들은 야간 사냥을 위해 고주파의 청각 신호를 방출하고 수신한다. 하지만 그들은 매우 시끄러운 환경에서 살아가고 있다. PhysOrg(2016. 4. 1) 지는 박쥐가 난청에 시달림 없이, 일정한 소음에 대처하는 방법에 대해 이야기하고 있었다.


돌고래 : 플로리다 대학의 연구자들은 한 수수께끼를 풀기 위해 돌고래(dolphins)를 연구했다. 두 돌고래가 양쪽 끝에서 동시에 함께 밧줄을 잡아당겨야 열 수 있는, 먹이가 들어있는 용기를 설치했다. New Scientist(2016. 4. 15) 지는 돌고래들이 그 문제를 해결하기 위해 함께 일할 때 나타난 특별한 언어를 어떻게 들었는지를 말하고 있었다. 박쥐처럼, 돌고래는 먹이를 찾기 위해 수중 음파탐지기를 사용한다. ”이것은 돌고래의 발성(vocalisations)이 협력 작업을 위해 사용됐다고 결론적으로 말할 수 있는 최초의 발견이다.” 연구자들은 말했다.



통신망 이론에서, 통신망을 구성하고 있는 재료 물질은 중요한 것이 아니다. 중요한 것은 정보와 전달 시스템이다. 통신망에 사용되는 재료는 다른 것으로 교체될 수 있고, 여전히 같은 정보를 통신할 수 있다. 이것은 통신망에서 중요한 것은 정보임을 가리킨다.


한 소식을 친구에 말하고, 친구는 그것을 컴퓨터로 쳐서 멀리 있는 친구에게 이메일로 보내고, 그 친구는 또 다른 친구에게 그것을 칠판에 적어 보게 하고, 조종사들에게 무선으로 전달되고, 농아인 사람을 위해 수신호로 전달되고, 중국어로 번역해서 중국 친구에게 전달되고... 이렇게 전달되는 것들은 모두 동일한 메시지이다. 정보는 정보를 전달하는 재료 물질보다 더 중요하다. 동식물의 세포 내에 들어있는 엄청난 량의 정보를 생각해 보라. DNA나 단백질보다 그 안에 들어있는 정보가 더 중요한 것이다.  DNA나 단백질들이 자연적인 과정으로 우연히 생겨나는 것은 불가능해 보인다. 더군다나 DNA 내에 들어있는 막대한 량의 유전정보들과 전달시스템은 어떻게 생겨났는가? 모두 우연히 생겨났는가?


존 아치볼드 휠러(John Archibald Wheeler)는 '비트에서 존재로(It from bit)'라는 유명한 말을 했다. 윌리엄 뎀스키(William Dembski)는 우주의 기본 재료로서 정보를 말하고 있었다. 그의 심오한 책 ‘영적 교감의 존재(Being as Communion)’을 읽어보라.


자연에서 정보-우선의 견해는 성경적 세계관과 적합하다. 하나님은 말씀으로 이 세계를 만드셨다. 하나님은 생물들이 번성할 수 있도록 뭍이 드러나라고 말씀하셨다. 그 분은 에덴동산에서 아담과 하와와 교제하셨고, 모세에게 하나님의 법을 말씀하셨다. 그 분은 우리의 양심에 도덕성을 넣어 놓으셨고, 그분의 말씀에 영감을 불어 넣으셨다. 말씀이 육신이 되어 오신 예수님은 하나님이 전하라고 하신 것들을 말씀하셨다. 예수님의 부활 후에, 예수님은 제자들에 나타나셔서 큰 임무를 부여하셨다. 믿음은 들음에서 나며, 입으로 예수를 주로 시인하면 구원을 얻는다. 교회는 지역적으로 보편적으로 성도들의 교제이다. 천국에서 우리는 창조주이신 전능하신 하나님과 영원히 교제하며 살아갈 것이다.



번역 - 미디어위원회

링크 - http://crev.info/2016/04/life-as-the-communication-of-information/ 

출처 - CEH, 2016. 4. 28.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6380

참고 : 6266|5954|5949|5947|6142|6143|5540|4672|5775|3373|3358|3293|6321|6314|6207|6148|6003|5900|5836|5831|6134|6126|6000|6009|5883|5784|5734|5580|5474|4408|3183|4034|3674|5608|6161|5488|4676|6178|5959|5046

Brian Thomas
2016-04-29

토양 곰팡이가 철을 캐내는 방법은 설계를 가리킨다. 

(Iron-mining Fungus Displays Surprising Design)


      토양 곰팡이(soil fungus)는 필요한 영양분인 철(iron)을 미량 포함하고 있는 단단한 광물을 만났을 때, 놀라운 일을 수행하고 있었다. 볼품없어 보이는 곰팡이는 버려진 국수처럼 활기 없고 나약해 보이지만, 연구자들은 최근 토양 곰팡이가 초소형 채광 작업을 수행하고 있음을 밝혀냈다. 그 세부적 방법은 합리적인 설명을 필요로 하며, 곰팡이가 매우 잘 설계된 유기체임을 가리키고 있었다.


중국의 연구자들은 중국 둥하이(Donghai)의 사문암(serpentinite) 광산에서 나온 토양 곰팡이 탈라로미케스(Talaromyces flavus)를 실험했다. 연구자들은 곰팡이가 리자다이트(lizardite, 사문암 암석에서 발견되는 독특한 광물)라 불리는 녹색 광물에 도달했을 때, 무슨 일이 일어나는지를 정확히 평가하기 위해서 다양한 기술을 사용했다. 연구자들은 그들의 발견을 Geology 지에 발표했다.[1]


첫째, 곰팡이는 그 주변을 조사하는, 균사(hyphae)라 불리는 얇은 필라멘트를 확장시킨다. 그것이 적합한 암석에 접촉했을 때, 균사는 즉시 광물 표면을 분해하는 산(acid)을 분비한다. 이것은 미량의 철을 방출시킨다. 이 첫 번째 단계는 곰팡이가 민감하고 정확하게 철을 탐지할 수 있는, 초소형 철-검출 메커니즘을 갖고 있음을 의미한다. 또한 하등하다고 말해지는 곰팡이가 철의 발견 사실을 자신의 내부 기관과 통신하고 있다는 것을 의미한다. 그에 대한 응답으로, 특정한 산의 생산 및 운송 경로가 활성화되는 것이다.


그러나 산 분비에 의한 광물 부식이 (이것도 놀라운 일이지만) 토양 미생물이 하는 일의 전부가 아니다. 멀리에서 조금씩 캐낸 철을 어떻게 끌어들이는 것일까? 이 문제를 해결하기 위해서, 토양 곰팡이 탈라로미케스는 시데로포어(siderophores)라 불리는 독특한 철-포착 화학물질을 만들어서 내보낸다. 이들은 철 원자에 근처에서 토양 미생물이 기본적으로 한 번에 한 원자를 회수할 수 있도록 해준다.


이 시점에서, 광산 곰팡이는 또 다른 장애물을 만나게 된다. 광물의 표면으로부터 철을 추출하는데 사용되는 동일한 산이 또한 실리콘과 산소와 반응하여, 겔과 같은 실리카 층을 형성하기 때문이다. 이 실리카 층은 화학적 추출의 진행을 방해한다. 이에 굴하지 않고, 곰팡이는 물리적으로 광물을 채굴하기 시작한다.


Geology 연구의 저자들은 곰팡이 균사가 철을 함유한 광물 리자다이트가 보유하고 있는 화학결합의 힘보다 두 자릿수나 더 큰 힘을 발생시킬 수 있음을 계산했다.[2] 단단한 층에 접근하기 위해 실리카 겔을 관통함으로써, 곰팡이 균사는 신속하게 새로운 철 근원을 노출시킨다.


산은 철을 노출시키고, 시데로포어는 철을 포획한다. 균사는 새로운 영역을 개척한다. 그리고 이 사이클은 계속된다. 광산 공학자들이 광석에서 금속을 채취 침출할 때 사용하는 단계와 매우 유사한 조절된 단계들을 구사하고 있는 것이다.  


이것은 마치 누군가가 곰팡이의 성장에 철이 중요함을 알고 있었던 것처럼 보인다. 또한 곰팡이는 주변으로 달려갈 수 없지만, 철 근원을 탐지하고 채취해야만 한다는 것을 알고 있었던 것처럼 보인다. 그러므로 암석으로부터 철 광물을 채굴하는 데에 필요한 모든 장비들이 장착되어 있는 것이다.


연구의 저자들은 썼다. ”더 강력한 시데로포어 생산이 배양-광물 경계면 아래에 영향 받지 않은 철(Fe, iron) 분포와 함께, Exp-mixP(fungus-mineral interface)에서 검출되었다. 따라서 리자다이트의 세포 촉진 용해(~ 4.6%의 Fe2O3 함유)는 철 추출을 위해 의도된 것임을 가리킨다.”


물론 그러한 의도적인 일은 지성과 의지 없이 일어날 수 없다.

이 연구에 대한 Science News의 리뷰 글에서, 과학부 기자 에릭 핸드(Eric Hand)는 썼다. ”곰팡이 Talaromyces flavus는 단계적으로 자신이 원하는 것을 획득하는 방법을 알고 있었다.”[3] 그렇다. 곰팡이는 알고 있었다. 곰팡이는 그것은 스스로 학습할 능력이 없기 때문에, 누군가가 곰팡이 안으로 '그 방법'을 프로그래밍해서 넣어주었음에 틀림없다.


지구화학자이며 책임 저자인 헨리 탕(Henry Tang)은 Science News에서 말했다 : ”이 곰팡이는 뇌를 가지고 있지 않지만, 꽤 똑똑하다.” 실제로 그들은 현명했다. 광물 채광 곰팡이는 전지하신 창조주로부터 부여된 놀라운 채광 방법을 갖고 있었던 것이다.



References
1. Li, Z. et al. 2016. Cellular dissolution at hypha- and spore-mineral interfaces revealing unrecognized mechanisms and scales of fungal weathering. Geology. 44 (4): 319-322.
2. According to the Geology report, the turgor pressure exerted by a 1 X 10 nm hyphal peg is on the order of 10-16 J, whereas the Mg-O bond energy is about 10-18 J.
3. Hand, E. Iron-eating fungus disintegrates rocks with acid and cellular knives. Science News. Posted on sciencemag.org March 14, 2016, accessed April 6, 2016. 



번역 - 미디어위원회

링크 - http://www.icr.org/article/9301

출처 - ICR News, 2016. 4. 21.

구분 - 4

옛 주소 - http://www.kacr.or.kr/library/itemview.asp?no=6373

참고 : 3930|5735|5099|6002|4267|4424|4122|3897|2992|4821|5136|6096|6128|5569|6210|6201|6015|4444|3881|3789|3768|3585



서울특별시 중구 삼일대로 4길 9 라이온스 빌딩 401호

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 오경숙

사업자번호 : 120-87-70892

통신판매업신고 : 제 2018-서울중구-0764 호

주소 : 서울특별시 중구 삼일대로 4길 9, 라이온스빌딩 401호

대표전화 : 02-419-6484

개인정보책임자 : 김광