끝까지 버티는 다윈의 신화 : 흔적기관과 침팬지와 유사성이 98.8%라는 거짓 주장

미디어위원회
2020-08-20

끝까지 버티는 다윈의 신화

: 흔적기관과 침팬지와 유사성이 98.8%라는 거짓 주장

(Darwin Myths Die Hard)

Jerry Bergman


      진화론의 신화는 부정된 후에도 오랫동안 지속된다. 어떤 경우에는 150년 이상!


   인간의 기원에 대한 다윈의 이야기를 뒷받침하는 진화론적 신화들은 위조로 판명된 이후에도 대중에게 무비판적으로 받아들여지는 경향이 있다. 다음은 몇 가지 예이다.


흔적기관

하나의 예는, 사람 눈에서 "깜박막(nictitating membrane, 순막)"으로 주장됐던 것이다. 이것은 먼 진화론적 조상으로부터 남겨진 흔적기관이라는 것이었다. 라틴어로 눈 깜박임(nictare)에서 유래한 깜박막은 시력을 유지하면서, 눈을 먼지로부터 보호하고, 수분을 공급하기 위해 눈을 가로질러 움직일 수 있는, 투명한 제3의 눈꺼풀이다. 다윈은 이 구조에 관해 설명하면서, 파충류가 우리의 조상이라는 증거로 사용하였다.

.2019년 발간된 제리 버그만의 책, ‘쓸모없는 기관 : 진화론의 한 중심적 주장의 흥망성쇠(Useless Organs : the Rise and Fall of a Central Claim of Evolution)’ 


그러나 1920년대에 주장됐던 사람 눈에서의 깜박막은 사실 깜박거리는 막도 아니고, 흔적기관도 아니었다. 그것은 반월주름(plica semilunaris, 반달모양의 주름)이었다. 그것은 매우 다른 목적을 갖고 있는 매우 다른 구조였다. 반월주름은 눈의 내안각에 있는 작은 결막 조직의 주름으로, 눈물의 배수를 유지하고, 안구의 회전을 더욱 원활하게 해준다.[1] 실제로 이 반월주름이 없다면, 결막은 안구에 직접 부착되어 움직임이 제한된다.[2] 이 잘못된 깜박막 개념은 1871년 찰스 다윈(Charles Darwin)이 아닌 다른 누군가에 의해 시작되었다. 하지만, 그것은 여전히 1세기 반이 지나서도 흔적기관의 주요한 예로써 계속 선전되고 있는 것이다![3] 권위 있는 브리태니커 백과사전(Encyclopedia Britannica)은 흔적기관 목록에서 4번째로 깜박막을 올려놓고 있다![4] 브리태니커 백과사전은 흔적기관을 “진화 역사의 잔존물”로 설명하고 있다.


1% 라는 신화

최근 비즈니스 인사이더(Business Insider) 지는 또 다른 다윈의 신화를 강조해서 말하고 있었다. “우리의 유전자(DNA)는 바로 옆 사람과 99.9%가 동일하다. 인간의 유전자는 놀랍게도 다른 생물의 유전자와도 많이 비슷하다.” 그 기사는 침팬지와 키스하고 있는 영장류 과학자 제인 구달(Jane Goodall)의 사진과 함께 소개되고 있었다. 애니메이션의 삽화와 강조된 굵은 글씨를 사용하여, 유사성 목록(list of similarities)을 만들어 다윈주의를 선전하고 있었다.

• 인간과 인간의 유전적 유사성은 99.9%이다.

• 인간과 침팬지의 유전적 유사성은 96%이다.

• 인간과 고양이의 유전적 유사성은 90%이다.

• 인간과 쥐의 유전적 유사성은 85%이다.

• 인간과 젖소의 유전적 유사성은 80%이다

• 인간과 초파리의 유전적 유사성은 61%이다.

• 인간과 닭의 유전적 유사성은 60%이다.

• 인간과 바나나의 유전적 유사성은 60%이다.[5]

이것은 인간과 진화론적으로 먼 친척들로부터 가까운 생물들을 배치하면서, 우리가 진화론적으로 진보하여 왔음을 홍보하려는 뻔뻔한 시도이다. 그들의 주장에 의하면, 인간과 닭의 유전적 거리가 인간과 바나나와의 거리와 같다고 결론내리고 있는데, 얼마나 터무니없는 것인가? 그러나 자세히 들여다보면, 이 기사의 문제점은 인간과 쥐 사이의 85% 유사성은, 단지 단백질을 인코딩하는 유전자(protein-encoding genes)만을 비교한 것이다. 단백질을 코딩하지 않는 유전자(non-protein coding genes)의 경우, 유사성은 단지 약 50%에 지나지 않는다. 실제로 인간과 침팬지를 비교하기 위해서는, 이런 부분이 강조되어야 한다. 일반 독자는 제목만 보고, 정작 그 안에 있는 중요한 사실을 놓치게 된다.

구글에서 검색해보면, 침팬지와 인간의 유전적 유사성은 95%, 심지어 99%라고 쓰고 있는 수천의 글들을 보게 된다. 그러한 주장은 책 제목으로도 발견되는데, ‘인간과 침팬지 : 인간과 침팬지의 유전자는 96% 유사하다’라는 책도 있다.[6] 이 책에서 “연구자들은 침팬지의 유전자 염기서열을 분석했으며, 사람과 침팬지는 96%가 유사하다는 것을 발견했다. 모두가 알아야 할 매우 흥미로운 정보이다”라고 말한다. 또 다른 제목의 책은 “99% 원숭이: 진화는 어떻게 발전하는가”이다.[7] 이 책은 제목에서부터 ‘인간은 원숭이와 99% 같다’라고 주장하고 있다. 이런 잘못된 주장을 일부 유신진화론자(theistic evolutionists)들은 받아들이고 있다. 예를 들어, 캐나다에서 가장 큰 기독교대학의 생물학 교수이며, BioLogos의 유신진화론자인 데니스 베니머(Dennis Venema)는 다음과 같이 썼다. “우리 전체의 유전체가 침팬지와 95% 혹은 98% 동일하다고 하는 것의 의미는 우리의 유전자 가운데 작은 DNA 블록들이 얼마나 소실되었는가에 달려있다.”[8]

마찬가지로, 단 1%의 차이라는 신화는 선도적 과학 잡지들에서 끊임없이 반복되고 있다. Smithsonian Magazine의 ‘현재 상태를 유지하는 현명한 소식’이라는 제목의 기사에서 "99% 침팬지라는 것은 무엇을 의미할까?"라고 묻고 있다. 그런 다음 그 기사는, 그것이 의미하는 바는, 즉 우리 인간은 99% 침팬지라는 것이다. 가장 권위 있는 과학저널에서도 이런 잘못된 거짓 신화는 구역질날 정도로 반복되고 있다. Scientific American의 기사는 “대부분의 연구에서 침팬지와 인간 사이에서 유전체가 비교됐을 때, 약 98.5%의 염기서열이 동일하다는 것이 밝혀졌다”고 말한다.[9] 또 다른 예로, Science 지는 “2005년 침팬지의 유전체가 분석된 이후로, 인간과 침팬지의 유전자는 약 99%를 공유하고 있고, 침팬지는 우리의 가장 가까운 친척이다”라고 말하고 있었다.[10] 마지막 예로, Nature 지의 한 보고는 “우리 DNA의 거의 98% 이상이 가장 가까운 살아있는 친척인 침팬지와 같다”고 쓰고 있었다.[11]


1%라는 주장이 산산조각 남

그러나 이러한 주장은 최근의 연구에 의해 산산조각이 났다. 미국을 대표하는 과학 잡지인 Science 지의 한 기사는 “상대적 차이: 1%라는 신화”라는 제목의 글을 보고했다.[12] 이 기사는 올해 발표된 것이 아니다. 이 논문은 13년 전인 2007년에 게재됐던 것이다! 그러나 그 이후에도 그러한 신화는 책들과 기사들에서 반복되어왔던 것이다! 저자는 1% 라는 주장이 처음부터 문제가 있었다고 설명하고 있었다 :

2005년에 침팬지 시퀀싱 및 분석 컨소시엄(Chimpanzee Sequencing and Analysis Consortium)의 연구자들은 우리와 가장 가까운 친척인 침팬지의 유전체를 연구하여, 가장 극적인 증거들을 발표했다. 컨소시엄 연구자들은 인간과 침팬지 각각에서 24억 개의 염기서열을 분석했으며, 이들이 1.23 %의 차이를 나타낸다고 보고했다. 그러나 침팬지 컨소시엄이 지적한 바와 같이, 이 수치는 유전체에 삽입되거나 삭제된 유전자(DNA) 전체가 아니라, 단지 염기가 치환(base substitutions)된 것만을 반영한 것이었다.[13]   

더 심도 깊은 연구는 훨씬 큰 차이가 있음을 밝혀냈다. "한(Hahn) 및 동료들은 2006년 12월 PLoS ONE 지에 발표된 논문에서, 인간과 침팬지 유전자 복사본의 수(gene copy numbers)는 무려 6.4%의 많은 차이가 났다"고 밝혔다.[14] 그리고 그들은 시스템 생물학(systems biology)을 이용하여, 인간과 침팬지 뇌의 유전적 차이를 정량화하고 분석했다. UCLA 생물 통계학자 스티브 호르벳(Steve Horvath)과 게쉬윈드(Geschwind)는 절제된 뇌의 특정 영역에서 4,000여개의 유전자들이 동시에 켜지거나, "동시 발현된" 유전자를 비교했다. 이러한 데이터를 바탕으로, 각 종(種)에 대한 유전자 네트워크를 구축했다. 그들은 “네트워크에서 한 유전자의 위치는 커다란 의미를(유사성 비율은 매우 제한적임을) 갖는다”라는 결론을 내렸다. 다른 유전자와 가장 빈번하게 공동 발현되는 유전자들은 가장 기능적으로 관련 있는 것으로 밝혀졌다.[15] 그리고 2006년 기사에서 “각 생물 종의 각각의 군집 네트워크 지도(map)에 대한 비교는 특정 연결이 인간에게는 있지만, 침팬지에는 존재하지 않음을 분명히 보여주었다. 예를 들어, 피질(cortex)에서 이런 연결의 17.4%는 인간에게만 고유한 것이다.”[16]

지금은 2020년이다. 그래서 인각과 침팬지의 유사성 문제는 확실히 해결되었다. 그렇다면 정확히 몇 %가 다르다고 말할 수 있을까? 이에 대해서는 2007년 기사를 인용하는 것이 좋을 것이다 :

연구자들이 밝혀낸 모든 것을 결합하여, 인간과 침팬지의 차이를 정확하게 몇 %라고 말할 수 있을까? 침팬지 컨소시엄의 한 연구자인 독일 라이프치히의 막스플랑크 진화인류학 연구소(Max Planck Institute of Evolutionary Anthropology)의 유전학자 스반테 파보(Svante Päabo)는 “나는 숫자를 계산할 방법이 없다고 생각한다. 결국, 우리가 차이점을 보는 방법은 정치적, 사회적, 문화적 문제이다.”

이것은 이 이슈에 대해 잘 설명하고 있으며, 13년 전에 대중에게 들려졌어야 했다. “결국 우리가 차이점을 보는 방법은 정치적, 사회적, 문화적 문제이다”라는 스반테 파보(Svante Päabo)의 말은 정확한 것이다. 1%의 차이라는 주장은 과학이 아니라, 정치적 목적을 위한 과학의 심각한 왜곡이다. 그 기사는 “오늘날 두 종은 유전적으로 99% 동일하다는 것으로 받아들여지고 있다.” 그리고 “1%의 차이는 자명한 이치라는 주장은 철회되어야 한다”고 덧붙였다. 지난 13년 동안 진화론자들은 이런 현명한 사람들의 충고를 무시했다.


최신 연구

더 자세한 최근 연구에 따르면, 최상의 유전자 비교 추정치는 99%, 95%, 또는 90%가 아니라, 약 84%의 유사성에 불과하다는 것이다. 16%의 차이는 약 5천만 개의 염기쌍이 다르다는 것을 나타낸다.[17] 23개의 인간 염색체의 길이는 약 1.8m로, 적절한 길이로 나누어 시퀀싱을 하고, 조립하여 분석한다. 초기 DNA 시퀀싱 작업에서, 과학자들은 매우 짧은 DNA 분절(segments)에 대해서만 염기서열을 분석할 수 있었다.

따라서 연구자들은 혈액 글로빈(globin) 단백질과 같은, 동물들 사이에서 매우 유사할 것으로 생각되는 DNA 분절에 초점을 맞추었다. 그러나 이 유전자들에서도 문제가 있었다. 침팬지 유전체(genome)은 인간 유전체보다 훨씬 길다 : 인간 유전체에는 3,096,649,726개의 염기쌍이 있고, 침팬지 유전체에는 3,309,577,922개의 염기쌍이 있다. 즉 6.4%의 개수 차이가 난다.[18] 더군다나, 인간은 46개의 염색체를 갖고 있고, 침팬지는 48개의 염색체를 갖고 있다. 따라서 아래와 같이(첫 번째 줄과 두 번째 줄 사이에) 거의 일치하지 않는 두 염기서열의 유전자를 비교하는 것은 어렵다 : 

ATTTGGGGTCCTTTTCCCGTAGTAACCTTCCCAAATGTTTGGCATCGTACGCTG

AAGGGTTGGGGAATATAGGGCGCGCGTATAGCGCGTGTGTTCTCTCGTACTAA

진화론자들은 이러한 거대한 차이가 나는 부분을 무시하고, 유사성에 초점을 맞추는 경향이 있다. 또한 비코딩 영역(non-coding regions)은 중요한 조절 기능을 갖고 있는 것으로 확인되고 있다. 이것이 확인되기 전까지 '정크(쓰레기) DNA(junk DNA)'라고 불렸었다.

여기 또 다른 오류가 있다. 인간에는 존재하지만, 침팬지에는 존재하지 않는 DNA 염기서열은 의미 있는 비교를 할 수 없게 만든다. 따라서 비교는 주로 헤모글로빈과 같은, 혈액 세포 단백질의 암호가 들어있는 유전자 영역을 비교하는 것이었다. 헤모글로빈이 기능하기 위해서는, 단백질이 매우 특정한 모양이어야 하기 때문에, 그들은 매우 유사한 유전자를 가질 것으로 예상될 수 있다. 결과적으로, 동일한 기능적 유사성을 필요로 하는 종들 사이에는 상당한 유사성이 존재할 수 있다. 그러나 중요하지 않다고 생각하는, 비코딩 영역은 훨씬 많은 차이를 보여주고 있음에도, 코딩 영역만으로 유사성을 주장한다면, 전체 유전체의 유사성은 상당히 왜곡되는 것이다.

그리고 일부 연구자들의 연구는 일종의 사기(fraud)인 것이다. 침팬지 염기서열을 분석한 한 실험실은, 진화론적 가정에 기초하여, 침팬지에는 없는(존재하지 않는) 염기서열이 있는 유전자의 경우, 그 간격을 메우기 위해서 침팬지 유전체에 인간 DNA 염기서열을 삽입했음을 인정하고 있었다. 따라서 논문으로 보고된 침팬지 유전체의 염기서열 분석은 부분적으로 인간 유전체를 기반으로 한 것이므로, 결과적으로 실제보다 훨씬 더 인간에 가까운 것으로 보여지는 것이다!

또 다른 주의해야할 사항은 단백질 암호를 갖고 있는 코딩 유전자는 선택적 접합(alternative splicing, 선택적 스플라이싱, 잘라붙임)을 통해, 많은 다른 개별 m-RNA 변이체들을 생산해낼 수 있다. 예를 들어, 단지 30,000개 이하의 유전자로 백만 가지 이상의 단백질들을 만들어낼 수 있으며, 이는 인간에 존재하는 것으로 추정되는 유전자의 수에 가깝다. 이러한 변이체들 중 다수는 후성유전학적(epigenetic) 메커니즘을 통해 생산된다.

따라서 인간 유전자와 침팬지 유전자는 유사성이 있다 하더라도, 발현되는 단백질들에서 큰 차이를 만들어낼 수 있다. 인간과 침팬지의 후생유전학적 차이는 유전자 자체의 차이보다 훨씬 클 가능성이 높다. 이 몇 가지 요점들은 인간과 침팬지 유전자형 사이에 커다란 간격이 존재하며, 이는 인간과 침팬지 표현형 사이에 존재하는 간격을 설명하는데 도움이 된다.


요약

다윈의 신화에 대한 이 두 가지 사례(눈의 흔적기관과 인간과 침팬지의 1% 차이)는 필자의 책에서 보고했던 많은 진화론의 오류, 사기, 위조들 중 하나이다. 그들은 모두 하나의 공통점을 갖고 있다. 즉, 진화론자들은 강한 동기를 갖고 진화론을 과학적으로 그럴듯하게 보이기 위해 애쓰고 있다는 것이다. 우리가 보았듯이 사실은 그렇지 않다. 그럼에도 불구하고, 많은 진화론의 신화들은 과학자들과 언론 기자들에 의해서 대중에게 계속 호도(糊塗)되고 있는 것이다.

.2017년 제리 버그만의 책, '진화론의 사기, 실수 및 위조(Evolution's Blunders, Frauds and Forgeries)'.



References

[1] Bergman, Jerry. 2019. Useless Organs: The Rise and Fall of the Once Major Argument for Evolution. Tulsa, OK: Bartlett Publishing.

[2] Dartt, Darlene A. 2006. “The Conjunctiva—Structure and Function.” Chapter 2 in Duane’s Foundations of Clinical Ophthalmology.  Philadelphia, PA: Lippincott Williams & Wilkins.

[3]  Darwin, Charles. 1871. The Descent of Man, and Selection in Relation to Sex. London, England, UK: John Murray, pp. 23, 207 in Volume 1.

[4] Rogers, Kara. “7 Vestigial Features of the Human Body.” Encyclopaedia Brittanica. https://www.britannica.com/list/7-vestigial-features-of-the-human-body

[5] Lydia Ramsey and Samantha Lee, “Our DNA is 99.9% the same as the person next to us — and we’re surprisingly similar to a lot of other living things.” Business Insider, April 3, 2018.

[6]  [Could not locate cited source. An alternate suggested reference: https://www.genome.gov/15515096/2005-release-new-genome-comparison-finds-chimps-humans-very-similar-at-dna-level.]

[7] Silvertown, Jonathan (ed.). 2009. 99% Ape: How Evolution Adds Up. Chicago, IL: The University of Chicago Press.

[8] The BioLogos Forum. https://discourse.biologos.org/t/human-chimp-genome-similarity/38409.

[9] Deininger, Prescott. 2004. What does the fact that we share 95 percent of our genes with the chimpanzee mean? And how was this numbered derived?  Scientific American. March 1. https://www.scientificamerican.com/article/what-does-the-fact-that-w/

[10] Gibbins, Ann. 2012. Bonobos Join Chimps as Closest Human Relatives. Science. June 13.  https://www.sciencemag.org/news/2012/06/bonobos-join-chimps-closest-human-relatives

[11] Gunter, Chris, and Ritu Dhand. 2005. The chimpanzee genome. Nature 437: 47, September 1. https://www.nature.com/collections/srwbvyfghj.

[12] Cohen, Jon. 2007. “Relative Differences: The Myth of 1%.” Science 316:1836, June 29.

[13] Cohen, 2007, p. 1836.

[14] Cohen, 2007, p. 1836.

[15] Cohen,  2007, p. 1836. Emphasis added.

[16] Cohen,  2007, p. 1836.

[17] Bergman, Jerry. 2020. Apes as Ancestors: Examining the Claims About Human Evolution. Tulsa, OK: Bartlett Publishing. Co-Authored with Peter Line, Ph.D., and Jeffrey Tomkins, Ph.D. Chapter 5: “Are Humans and Chimps 98% Similar?” Jeffrey Tomkins, Ph.D. & Jerry Bergman, Ph.D.

[18] http://useast.ensembl.org/Homo_sapiens/Info/Annotation.


*Dr. Jerry Bergman has taught biology, genetics, chemistry, biochemistry, anthropology, geology, and microbiology for over 40 years at several colleges and universities including Bowling Green State University, Medical College of Ohio where he was a research associate in experimental pathology, and The University of Toledo. He is a graduate of the Medical College of Ohio, Wayne State University in Detroit, the University of Toledo, and Bowling Green State University. He has over 1,300 publications in 12 languages and 40 books and monographs. His books and textbooks that include chapters that he authored are in over 1,500 college libraries in 27 countries. So far over 80,000 copies of the 40 books and monographs that he has authored or co-authored are in print. For more articles by Dr Bergman, see his Author Profile.


*관련기사 : 인간과 DNA 98.8% 일치하는 침팬지 (중앙일보. 2020. 1. 4)

https://news.joins.com/article/22257317


*참조 : 사람과 침팬지의 DNA 유사성이 98% 이상인가? 그렇지 않다.

http://creation.kr/Variation/?idx=1290341&bmode=view

인간의 2번 염색체에서 융합은 결코 일어나지 않았다 : 사람과 원숭이류의 염색체 수 차이에 대한 진화론적 설명의 실패

http://creation.kr/Apes/?idx=3876591&bmode=view

보노보 유전체 해독에서 반-진화론적 비밀 : 유사한 영역만 비교하여 98.7%가 유사하다?

http://creation.kr/Apes/?idx=1852163&bmode=view

사람과 원숭이의 유전자 차이는 이전 보고의 4배

http://creation.kr/Mutation/?idx=1289754&bmode=view

사람과 침팬지 사이의 유전적 차이가 재계산되었다. 

http://creation.kr/Apes/?idx=1852205&bmode=view

1%의 신화 : 인간과 침팬지의 DNA는 매우 다르다.

http://creation.kr/Apes/?idx=1852185&bmode=view

사람과 침팬지의 Y 염색체 차이는 30% 이상이었다. 

http://creation.kr/Apes/?idx=1852097&bmode=view

진화론자들의 Y 염색체 충격 : 침팬지와 사람의 Y 염색체는 ‘끔찍하게’ 달랐다.

http://creation.kr/IntelligentDesign/?idx=1291705&bmode=view

사람과 침팬지의 DNA가 유사하다면, 왜 그렇게 많은 육체적 정신적 차이가 있는가?

http://creation.kr/Variation/?idx=1290374&bmode=view

사람과 침팬지의 DNA는 완전히 달랐다.

http://creation.kr/IntelligentDesign/?idx=1291692&bmode=view

사람 lincRNA 유전자는 진화론을 부정한다. : 침팬지의 lincRNA와 차이는 20% 이상이었다.

http://creation.kr/IntelligentDesign/?idx=1291733&bmode=view

또 하나의 진화론적 상징물이 무너졌다 : 진화론자들도 인간과 침팬지 DNA의 99%가 유사하다는 생각을 단념하다

http://creation.kr/Apes/?idx=1852048&bmode=view


출처 : CEH, 2020. 5. 27.

주소 : https://crev.info/2020/05/darwin-myths-die-hard/

번역 : 미디어위원회





















서울특별시 종로구 창경궁로26길 28-3

대표전화 02-419-6465  /  팩스 02-451-0130  /  desk@creation.kr

고유번호 : 219-82-00916             Copyright ⓒ 한국창조과학회

상호명 : (주)창조과학미디어  /  대표자 : 박영민

사업자번호 : 120-87-70892

통신판매업신고 : 제 2018-서울중구-0764 호

주소 : 서울특별시 종로구 창경궁로26길 28-5

대표전화 : 02-419-6484

개인정보책임자 : 김광